Advertising Five Steps to Help You Go From Beginner to Guitar HeroThe rise in popularity of guitar bands and the phenomenal success of the Guitar Hero video game franchise has lead to more and more people picking up the guitar recently. Sales of guitars in the UK has hit an all time high in the past three years and as more and more people are starting to play, the guitar has surpassed the piano as the most widely learned instrument in schools. With all these people learning I thought I'd pass on some tips from my 10 years of experience playing guitar and help point people in the right direction as they start learning their technique. In this article I've listed some things that I feel are very important to playing well but are often overlooked by those just starting out. If you're a seasoned player then there won't be much here for you, but if you're new to playing guitar then hopefully I can help out and perhaps shed some light on things you maybe hadn't thought about before. Theory The one factor that has improved my guitar playing beyond any other was taking the time out to learn the basics of music theory. Once you manage to break out of the pentatonic scales so overly used by rock guitarists you'll find that your song-writing and improvisation will come on in leaps and bounds. Believe it or not, by learning the scales you'll actually become far more free than when you didn't know them. Ironically, learning the rules of music has left me much more open to play expressively than before. Don't forget that once you know them, you can break them, and this is where your playing can really start to become interesting. So how did I go about learning the theory I needed for playing rock guitar, and how might you learn it too? Well, it hasn't been a fast process and I'm certainly not finished yet, I learn something new all the time and there is a massive amount I simply don't know yet. I started by learning a couple of major scale shapes, E major, C major and D major are good ones to start out with. Try finding a song you know in one of these keys and play over it, picking out the notes that sound good, and the notes that don't sound good. A good way to learn scales is by checking out some of the free guides floating around the Internet. I started out by learning a couple of positions for each scale, taking one or two at a time. Once you've done that a great method to help your soloing is to learn each scale on each single string. Take it slow at first, one or two strings at a time and just move on when you feel comfortable. The advantage of doing this is that before you know it, you will know every note you can hit on every string to stay in key and switching positions becomes a breeze. Once you're happy with the major scales you can start to pick up the minor keys, which is actually a lot easier than you might think. As well as learning scales I looked at chords and how they're built and how they work together. I would recommend learning the scales first, as once you have those down, constructing chords becomes much easier. The key factor when learning is not just knowing them parrot fashion like "this is a Cmin7", but rather learning why it is a C minor seventh. Once you know why the chords are then you can build them anywhere you need and you'll find it that bit easier to write great melodies over the top. A detailed guide to learning music theory is beyond the scope of this article but hopefully I've highlighted an area that may be lacking in your guitar playing. Remember even the most basic major and minor scales can make a world of difference when writing that next song, or improvising with your band. There are a huge range of free lessons available on the web, and some great tutorials on YouTube, so make sure you check them out. Bending Something I feel is crucial to being able to play rock guitar well is being able to bend the string accurately. String bending is what makes the electric guitar the instrument it is, having been used by countless guitarists to convey every kind of emotion you can imagine. When it is done well a big bend sounds amazing, but done badly it can sound terrible. If you have a great ear for music then you shouldn't have much trouble bending and keeping in key. If however you're like me and aren't blessed with a natural ear then you'll need to train yourself to bend accurately. For the best results when bending strings always try to use three fingers on your fretting hand. I find when playing rock the best method is to fret the start note with the ring finger and use your middle and index fingers to help control the string as you bend it. I generally bring my thumb over the neck and 'squeeze' the fretboard to bend the note. Some guitarists might argue that bringing the thumb round is bad technique but I find it helps your control and is useful for muting the strings you're not playing. Once you have a solid technique the first thing you need to do is make sure you're bending in key. Pick any note on your guitar. Then pick a note two frets up and play that. Play the two notes one after another getting used to the sound of the interval. Once you have the sound in your head, play the first note and then bend up to the second. This whole tone bend is the most commonly used in rock guitar playing and you should make sure you're comfortable with it. Once you've mastered that you can try single fret (semitone) bends and even three fret bends. Remember to always bend up to a note that is in key with the song you're playing, nothing sounds worse than an out of key bend! To hear some fantastic string bending listen to any guitar solo from Dave Gilmour of Pink Floyd. You should be able to hear a lot of blues style bends as well as really controlled bends across wide intervals. Vibrato Your vibrato can be defined as your touch or feel as you play. How you vibrato the notes you play can often define you as a guitarist and help to differentiate you from everyone else. For example take Yngwie Malmsteen with his super wide vibrato and then Steve Vai with a much more smooth and controlled sound. You can tell the two apart instantly. In fact I'd go as far as to say you could have them both play the same passage of music and you'd be able to tell the difference, even when playing the same notes. Vibrato is varying the pitch of a note as you hold it to give a vocal like quality and expression to your playing. The amount and the speed at which you vibrato the note is entirely down to personal preference, so really just experiment with everything you can think of. Try everything and see what you think sounds best. As a test, try playing a melody with some light vibrato. Then play again but don't vibrato a single note. The time without vibrato will often sound rather lifeless and uninteresting. It is an important technique to work on as once you have it down you'll sound like a real guitarist and not a beginner anymore. When I vibrato notes the motion generally comes from the wrist. I try not to overdo it and generally let the mood of the music decide how aggressively I vibrato the note. There isn't really a steadfast way to teach vibrato, I found the best method was to simply watch my favourite guitar players as they played and pick up techniques as I went along until I settled on a sound I felt comfortable with. Try some songs from Yngwie Malmsteen, Steve Vai and BB King to get a good idea of some different vibrato sounds. Timing Timing is everything. It doesn't have to as complex as Dream Theater but one thing is for sure, if you play out of time you'll sound rubbish. The issue of timing applies to lead and rhythm playing but of course is ten times more important for playing rhythm, after all, that's why you're playing it. A great way to make sure you play in time is to always practise with a metronome. They're cheap and available from every music shop, and failing that there are several free software metronomes floating round on the web. By always playing with a beat you'll be used to hitting your notes in time and sticking to a regular rhythm. Before I joined a band I never played to a beat and so for the first few practises my timing was quite out on places as I was just used to jamming around on my own. Remember that even the most simple of passages must be in time and that you need to be able to play your rhythm parts consistently. Picking An aspect that is often overlooked by new guitarists is their picking hand. I was the same, generally all the focus goes onto the fretting hand to make sure those chords stick and the bends sound good. However the picking hand is just as important and will have a big impact on your sound. There are a whole host of approaches when picking your notes while you play, you can play fast and precise or loose and slower and everything in-between. If you ignore your picking technique you'll have to go back and learn it again, which is what I had to do after three years of playing. A solid picking technique is vital for rhythm playing as you'll need to be able to reproduce the same thing every time you play the song. You'll need to make sure that your picking hand is synched up well with your fretting hand, you don't want to hit dead notes, especially on clean sections. The technique of picking properly is enough for a separate article, but just remember not to overlook it. Try searching YouTube for some videos from Paul Gilbert and John Petrucci on picking technique. For a looser feel you can always turn to Jimi Hendrix, Wind Cries Mary and Castles Made of Sand have some great sections in them for getting some new picking ideas. In conclusion. While I haven't covered anything groundbreaking here I certainly hope I may have uncovered some weaknesses in your playing that you can keep in mind as you work on your technique. These are often things I see new guitarists overlook in favour of playing some loud power chords or trying to shred away from the start. Remember that the key with learning anything new on the guitar is to start slow and make sure you can play it cleanly before moving up to speed. By taking things slow and learning the best techniques you'll become a much better and more versatile guitarist in the future. | Registered Users |
ENTER 10
Friday, 26 August 2011
ENTER10MENT
Saturday, 16 July 2011
MUSIC INTENSITY
What is Music?
The problem with answering the question “What is music?” is understanding
what would constitute a proper answer. Music arises
from human behaviour, and the study of human behaviour is part
of biology. So any question about music is a question about biology,
and every question about biology requires an answer within
the framework of Darwin’s theory of evolution by natural selection.
2.1 Music is Something We Like
What is music? It’s what comes out of the speakers when we play a CD
on our stereo. It’s what we hear on the radio. Music is singers singing and
musicians playing. Music is a sound that we enjoy hearing.
Is this a proper answer to the question “What is music?”?
If I asked “What is a car?”, you could answer by pointing at a large
object moving up the street and saying “It’s one of those.” But this may
not be a satisfactory answer. A full explanation of what a car is would
mention petrol, internal combustion engines, brakes, suspension, transmission
and other mechanical things that make a car go. And we don’t just want to
know what a car is; we also want to know what a car is for. An explanation
of what a car is for would include the facts that there are people and other
things (like shopping) inside cars and that the purpose of cars is to move
people and things from one place to another.
By analogy, a good answer to the question “What is music?” will say
something about the detailed mechanics of music: instruments, notes, scales,
rhythm, tempo, chords, harmony, bass and melody. This matches up with
the mechanical portion of our car explanation. It’s harder to answer the
18 Copyright
c 2004, 2005 Philip Dorrell
The Biology of Feeling Good
“What is it for?” part of the question. A simple answer is that music is
enjoyable—it makes us “feel good”. We could expand on this a bit and say
that music creates emotions, or interacts with the emotions we already feel
and, sometimes, it makes us want to dance.
2.2 The Biology of Feeling Good
The “feel good” explanation is worth something, but it isn’t entirely satisfactory.
Or, at least, it’s not satisfactory if you’re a professional theoretical
biologist.
What does music have to do with biology? Music is something that people
create and something that people respond to. People are living organisms,
and biology is the study of living organisms.
We can compare music to eating. Eating is a well-known activity. People
do it. Animals do it. We know what eating is: it is the ingestion of certain
substances into our digestive systems. The ingested substances, or food,
travel through the digestive system, where components of those substances
are broken down and extracted by various means for use within the body.
Leftover portions of the food get pushed out the other end.
We can explain eating at a psychological level: we eat when we feel hungry
because it makes us feel good. Being “hungry” can be defined as a feeling
of wanting to eat food. We can determine that we become hungry when we
haven’t eaten for a while,1 and that we stay hungry (and slowly get hungrier)
until we have eaten.
2.2.1 Having More Grandchildren
A professional biologist would explain the existence of hunger by saying that
it is adaptive or, equivalently, that it is an adaptation.
A biologist calls something an adaptation if it contributes to having more
grandchildren. Becoming hungry when we need to eat and eating when we
are hungry contribute to having more grandchildren in the following ways:
• As children we need to eat food to grow up into adults.
• We need to eat to have the strength and energy to survive, to secure a
mate, to do the mating itself, and then do all the work that comes afterwards,
i.e. raise the children. In particular, we need to raise our children
well enough that they can grow up and have children themselves.
• When a woman is pregnant, and also when she is breast feeding, she
needs to “eat for two”.
1There are other factors that influence hunger, such as whether it’s the time of day at
which we normally eat.
19
What is Music?
• We shouldn’t eat when we already have enough food in us, because:
– too much food at once will overload our digestive system,
– once we have enough food in us, there are other more important
things we should be doing instead of eating more food.
I refer to the need to contribute to having more grandchildren, rather than
just children, to emphasise the importance of the continued cycle of birth,
growth, development and reproduction. If something causes us to have more
children, but has a negative effect on the ability of our children to raise their
own children, to such an extent that it causes us to have fewer grandchildren,
then that something is not an adaptation.
Strictly speaking, biologists think in terms of long-term reproductive suc-
cess, i.e. having great-grandchildren and great-great-grandchildren, and so on
forever. But, for our purposes, “grandchildren” is a close enough approximation.
By the time most people get to having grandchildren, they no longer
have the major responsibility to raise them, so whatever enabled their reproductive
success to get that far will probably continue indefinitely anyway.
What made biologists think that everything had to be explained in terms
of having more grandchildren? Most people would concede that if some
species of organism does not have grandchildren, then pretty soon it is not
going to exist at all. But does that mean that every purposeful behaviour
of a living organism has to be explained in terms of long-term reproductive
success?
2.2.2 Charles Darwin and His Theory
The most important discovery in the history of biology was Charles Darwin’s
theory of evolution by natural selection.
Even today, when his theory underpins all of modern biology, there are
many people who refuse to believe that his theory is correct, or even that it
could be correct. More than a hundred and forty years after Charles Darwin
published his discovery, there is a whole industry of authors and pseudoscientists
“proving” that evolution does not occur, or that if it does occur
then it is not occurring by natural selection.
This book is not aiming to change the minds of people who are skeptical
about evolution. This is a science book, and it is based on a scientific point
of view that the universe we live in appears to be comprehensible in the way
that Albert Einstein remarked upon, and that furthermore it is reasonable
to proceed on the basis that those bits of the universe that we do not yet
comprehend will eventually turn out to be comprehensible.
The specific field of study concerned with understanding human behaviour
according to Darwin’s theory of evolution by natural selection is evolution-
ary psychology. The basic assumption of evolutionary psychology is that
20
The Biology of Feeling Good
our behaviour is determined in some manner and to some degree by our
genes.
Genes are the information about how our bodies develop and operate.
They are contained in molecules called DNA, which can be understood as
long strings of text written in a language with a 4-letter molecular “alphabet”.
If you read molecular biology papers in scientific journals, you will
see descriptions of genes written as strings containing the letters A, G, T
and C. These are the first letters of the chemical names for the four molecular
“letters” in the molecular alphabet: adenine, guanine, thymine and
cytosine.
AGTTTCTAGGTCGTGAAACTGTTCAGGCTTAAGTTGCGGTA
Figure 2.1. A stretch of (single-stranded) DNA shown as a sequence of A, G,
T and C.
For humans the strings of DNA are divided up into 23 pairs of chromo-
somes. Each chromosome is an unbroken stretch of DNA, usually tied up
in complex spiral patterns (to keep it safe and out of harm’s way when it is
not being used). Every cell in your body has these 23 pairs of chromosomes,
except for a few types of cell that don’t need to reproduce themselves. (Also
there are the gametes which are the intermediate stage between parent and
child, and which have only one of each pair of chromosomes.) The chromosomes
in each pair are similar to each other,2 and we get one of each type
of chromosome from each parent (via their gametes). For each pair of chromosomes,
each of our parents supplies one chromosome from their own pair
of chromosomes, or a mixture of both chromosomes in that pair. Darwin
didn’t know about DNA, and he didn’t understand the mechanics of genetic
shuffling and mixing that occurs when we have sex.3
When we reproduce, the central thing that reproduces is our DNA. For
us, as multi-cellular organisms, this happens when we reproduce to create
new organisms (i.e. babies), and also when the cells that make up our own
bodies reproduce in order to make our tissues grow. Most of the time the
DNA reproduces accurately, but bits of it can get changed or mutated. And
when these mutations occur, they will on average be preserved, and the next
time the DNA reproduces, the parts of the gene that were changed are no
2Exception: females have two X chromosomes, but males have one X chromosome and
one Y chromosome per cell. Furthermore, one of the female X chromosomes is always
rendered inactive within the cell.
3Gregor Mendel was the one who first learned about the genetics of sex. The science
of genetics as we know it today began when Mendel did his experiments on sweet peas.
Darwin’s theory of genetics involved a theory of “blending”, which didn’t work very well.
Unfortunately Mendel’s work did not become widely known until some time after Darwin’s
death.
21
What is Music?
more likely to change the next time than any other part of the gene that was
not changed.4
What happens to us if our DNA mutates? A lot of the time the answer
is nothing, because much of the information in our DNA has little effect on
how well our bodies work. In fact the notion of “gene” specifically refers to
a portion of DNA which does affect some particular part of how our body
develops or operates. Mostly this happens when a gene encodes the makeup
of a particular type of molecule called a protein. There are many types of
proteins that do many different things in our bodies. If DNA in one of your
genes changes, then the protein encoded by the gene will change, and this
could affect how the protein does whatever it does in your body. Ultimately,
the changed protein could change your long-term reproductive success.5 It
might make it better, or it might make it worse (which is actually far more
likely). If it makes it better, then you are going to have more grandchildren
and great-grandchildren and so on. If it makes it worse, then you are going
to have fewer grandchildren and great-grandchildren and so on than everyone
else.
An important part of Darwin’s theory is the idea that for every species
there is some limit as to how many individuals of that species can ever exist
at one time. Among other considerations, all life that we know of exists on
planet Earth, and the Earth is finite in size. In practice, most species hit
some limit long before they get to the point where their members occupy
every square and cubic inch of the planet. As the more successful genetic
variations form a constantly increasing proportion of the total population,
the less successful genetic variations must eventually disappear altogether.
When this happens, the species itself has undergone a permanent change.
The removal of less successful variations is the natural selection and the
resulting permanent change is the evolution.
Darwin realised that if the process of evolution went on for long enough,
species could change into new species that were as different from their ancestors
as different species are from each other. And if species sometimes
split into separate populations, and those populations happened to evolve in
different directions, then one species would turn into two or more species.
Taking this idea to its logical conclusion, Darwin supposed that all life on
Earth could have evolved from a single ancestral species:
Therefore I should infer from analogy that probably all the organic
beings which have ever lived on this earth have descended from some
one primordial form, into which life was first breathed.6
4This is probably not 100% true, as some locations in the chromosome may be more
susceptible to processes that cause mutation. It is more precise to state that the probability
of mutation at any given location on the chromosome can be a function of location, but
does not depend on whether the location in question has or has not recently suffered a
mutation.
5A mutation will affect your descendants if it occurs in a germ cell, which is a cell
from which the gametes (sperms or eggs) are descended.
22
Explaining Purposeful Behaviour
The modern technical term for this hypothetical “one primordial form” is
the Universal Common Ancestor (UCA).
Evolution by natural selection explains the characteristics of living organisms.
Each living organism is the result of a long sequence of individual minor
changes, and each minor change became fixed in the population because it
resulted in increased reproductive success. There are a few caveats to this
reasoning:
• Some changes may have resulted from genetic changes that had only a
very marginal effect on reproductive success. There is a certain probability
that some changes will become permanent even though they
have no effect or even a slightly negative effect on reproductive success.
This can happen particularly if a species is occasionally reduced to a
very small population, or if a new species evolves from a very small
sub-population of its ancestor species.7
• In some cases an observable aspect of a species’ behaviour will be attributable
to the effects of one or more evolved changes that occurred
in the past, but this aspect may not currently contribute to reproductive
success, even though the corresponding evolutionary changes did
contribute to reproductive success at the time they occurred.
2.3 Explaining Purposeful Behaviour
Whether or not a particular aspect of human behaviour requires to be explained
within the evolutionary framework is easier to decide if we restrict
ourselves to consideration of purposeful behaviour.
Purpose can be defined as a type of reverse causality. Causality is something
that flows forward in time. What was explains what is, and what is
explains what will be. With explanations involving purpose it’s the other way
around: what is explains what was, and what will be explains what is.
A normal causal explanation might be applied to a soccer player kicking
a ball that goes into goal: the ball with mass m was travelling at velocity
v1, when it made contact with the player’s foot (via his boot) at position p1,
which caused it to change velocity to v2, after which, according to the laws of
physics, it travelled in a path that caused it to go into the goal. In the causal
explanation, where and how the player kicked the ball determined the ball’s
path, which in turn determined the ball’s final destination inside the goal.
In the purposeful or teleological explanation, the ball going into the goal
explains the way that the player kicked the ball. That is, the result is treated
as the explanation of the events that caused that result. “The player kicked
6The Origin of Species Charles Darwin 1859
7Motoo Kimura developed the neutral theory of molecular evolution which emphasises
the importance of random (non-selective) processes in evolution.
23
What is Music?
the ball so that it would go into the goal.” If the ball had initially been in
a different location and travelling in a different direction, the player would
have kicked it differently, but he still would have kicked it in a way that would
have caused it to go into the goal.
Of course players don’t always get the ball into goal, even if they try (“try”
is a word whose meaning implicitly assumes purpose), but we still accept the
explanation that goes backwards in time: the player kicked the ball the way
he did because he was trying to get it into goal (and it nearly went in).
This distinction between causal explanations and teleological explanations
goes all the way back to Aristotle: he used the term efficient cause to describe
normal forward causality, and final cause to describe reverse teleological
causality.8
Modern science only admits efficient causes. A very simple way of justifying
this is to say that science only allows one explanation for any particular
aspect of reality that requires explanation. If we have two explanations of
the same phenomenon, either one explanation is not correct, or one of the
explanations is redundant and could have been restated in terms of the other.
In the case of the soccer player kicking the ball into goal, we accept the
correctness of both explanations: the ball went into the goal because of the
way it was kicked, and the ball was kicked the way it was so that it could go
into the goal. But these dual explanations only apply to purposeful phenomena.
For all other phenomena only the efficient cause type of explanation ever
applies. So we may assume that efficient causes are the more basic type of
explanation, and we must look for a way to restate the final cause explanation
in terms of efficient causes.
At which point we can directly apply Darwin’s theory of evolution by
natural selection. It is the cycle of reproduction and selection which converts
efficient causes into final causes. Various soccer players try to kick the ball
into the goal. The ones that get it in are seen as better players. The girls
fall in love with the good soccer players, and they have lots of children. The
children inherit the genes from their dads who were good soccer players, and
some of these genes determine the behaviour that caused their dads to kick
the ball into the goal. Maybe the genes give their owners stronger legs, or
better coordination, or create a propensity to practice more, or give them a
tendency to party less the night before an important match. Whatever the
case, in the next generation of soccer players there is a higher proportion of
those genes which make the players better at kicking balls into the goal.
This explanation does seem a little trite. The genes that contribute to
players being able to kick accurately may be genes that have quite general
effects, like being able to focus on achieving a result, or being able to develop
coordinated action. The ancestors of a good soccer player may never actually
have played soccer (or at least not professionally). They might have been
8Aristotle listed two other types of cause: material and formal, but we would tend to
include them as parts of efficient and final causes respectively.
24
Explaining Purposeful Behaviour
cricket players instead. Or perhaps the skills evolved to help them run away
from lions and throw spears at edible prey animals.9
But the general idea holds good: natural selection converts a final cause
explanation into an efficient cause explanation, protecting and preserving the
unity of all scientific explanations.
It also means we can stop feeling guilty about using teleological explanations,
as long as they fit into the theory of evolution by natural selection.10
Final causes can be chained together just like efficient causes. For example,
a chain of efficient causes is: I was able to have many grandchildren
because the girls liked me because I got rich because I kicked the ball into
the goal because I had practiced a lot because I always arrived at practice on
time. The corresponding chain of final causes is: I always arrived at soccer
practice on time so that I could consistently kick the ball into the goal so that
I could get rich from being paid well, so that all the girls would love me and I
could choose the best one to marry so that I could have many grandchildren.
We can use Darwin’s theory of evolution by natural selection to convert a
final cause explanation into an efficient cause explanation, as long as the very
last final cause in the chain of final causes is lots of grandchildren. If we end
up with a final cause of something else, then our teleological explanation is
not consistent with our otherwise consistent explanation of reality based on
efficient causes.
2.3.1 Incorrect or Apparently Incorrect Sub-Goals
Where does music fit in to this theory of purpose and causality? Certainly we
can identify purposeful causality in behaviours relating to music. “I worked
at the shop so that I could save up money so that I could buy a fuzz box so
that I could plug it into my guitar so that I could play ‘Smoke on the Water’.”
But the chain of final causes seems to stop when we get to the music itself.
Many of the unsolved problems of evolutionary science involve the existence
of final causes that appear not to have any explanation in terms of
more grandchildren: the chain comes to a stop in a bad place. Any number
of human behaviours seem to go directly against what is required for maximising
long-term reproductive success, behaviours such as driving too fast,
9This is a reference to the environment of evolutionary adaptedness (EEA): the
time when we lived in the jungle in hunter/gatherer tribes. The presumption is that not
much evolution has happened between that time and the present day, so any evolutionary
explanations must relate to those earlier circumstances as opposed to modern living conditions
with cars, roads, supermarkets etc. The EEA (as an explanation for modern human
behaviour) is discussed in more detail in Chapter 3.
10This is not a complete explanation of the existence of purpose in human (or animal)
behaviour: in addition to natural selection, there are selective processes operating within
the brain, which act to select those behaviours and behavioural strategies that (on average)
help us to satisfy our biological goals. The physiological mechanisms that underlie these
processes are themselves the result of evolution by natural selection, so there exists a twolevel
hierarchy of purposeful causality: natural selection has given rise to a purposeful
system of internal selection which acts to select purposeful behaviours.
25
What is Music?
sky-diving, being generous, fighting for your country, eating too much fat (or
just eating too much), eating sticky sweets that make your teeth go rotten,
and drinking too much alcohol.
How can we explain the existence of these apparently non-adaptive purposeful
behaviours? Plausible types of explanation include the following:
• The reproductive benefit is there, but just not so obvious to the untrained
observer.
• The purposeful behaviour results from some more general purpose which
benefits reproductive success on average.
• The behaviour used to benefit reproductive success, but times have
changed and now it doesn’t.
(The third explanation can be a special case of the second one: the behaviour
used to benefit reproductive success, now it doesn’t; in the future
it may become beneficial again.) Another possible explanation is that the
alleged behaviour isn’t quite what it seems: for example, maybe generosity
isn’t quite as common as it appears to be, because people are always doing
things to make themselves appear more generous than they really are.
Trying to explain non-adaptive purposes and purposeful behaviours is an
ongoing activity in the world of evolutionary psychology, and some of the
explanations that have been thought of are more convincing than others.
Here is a sample list of evolutionary explanations for some of the apparently
non-adaptive human behaviours given above:
• Wanting to drive too fast used not to be non-adaptive, because there
weren’t any cars. The instincts that make drivers want to drive too fast
had general benefits, encouraging our ancestors to learn how to move
quickly and efficiently without crashing into anything.
• There weren’t any opportunities to sky-dive in the distant past, on account
of the non-existence of parachutes—so a desire to sky-dive would
not have been non-adaptive.
• Dying for your tribe or country seems extremely non-adaptive, since
dead people can’t have children. But if society rewards warriors who
risk their lives for the sake of the tribe, then it can be argued that the
benefits going to those who risk their lives and survive more than make
up for the losses suffered by those who risk their lives and get killed.
• Eating a lot of fat can be beneficial if there is a substantial risk of
famine. The extra nutrients stored in the body of a fat person will help
them to survive the hard times.
26
Proof of our Ignorance About Music
• In the past, most available sweet foods would have been either ripe
fruit or honey. These are not quite as bad for your teeth as the boiled
sweets and toffees that are available in large quantities in the modern
supermarket. A desire to eat anything sweet is of particular advantage
to children, as they need the extra energy to play, and play is important
because it helps children develop their thinking and general life skills.
• Why people like to drink alcohol requires a different sort of explanation.
Alcohol and other recreational drugs, legal or illegal, act directly on
those parts of the brain that tell us if we have or have not achieved
our goals. The most that evolutionary theory can tell us about drugs
is that if a drug was widely available in the distant past, then humans
should have evolved some resistance to that drug.
2.4 Proof of our Ignorance About Music
This issue of explaining non-adaptive purposes will come up when we investigate
music. With music there is, however, a further complication: we don’t
even know what music is. Music is therefore a double mystery: we don’t
know the “what” and we don’t know the “why”. Maybe if we could solve
the “what” that would help us answer the “why”, or maybe if we could guess
what the “why” is we could find out the “what”.
There are a number of different ways I have found of demonstrating our
ignorance of what music is, and each provides a useful insight into the nature
of the problem:
• Subjective and Objective. The difference between knowing what
something is subjectively and knowing what it is objectively.
• The Martian Scientist. Could we explain to a Martian scientist what
music is?
• The Incompleteness of Music Theory. Here “music theory” refers
to the kind of music theory that you learn when you learn to play music,
and which will be presented in a basic form in Chapter 4. This music
theory tells us something about the structure of music, but beyond a
certain point it gives up.
• Lack of Formula. Despite common claims that some types of music
are “written to a formula”, there is no such formula, or if there is one,
no one is telling us what it is.
• The Economics of Music. Those who compose good music get paid
well, because making up good music is a hard problem. The very difficulty
of the problem results from our ignorance about what music is.
27
What is Music?
2.4.1 Subjective and Objective
We know what we know about things in the world around us because information
comes into our senses, and we process the information in our nervous
systems and brains to create knowledge about those things. Sometimes we
can convert this knowledge into symbolic natural language, i.e. by speaking
or writing. Sometimes other people can relate our symbolic descriptions of
things to their own experiences of the same things (or similar things).
If I see a sparrow, I can describe my observations of that sparrow to you.
You can relate that description to memories of sparrows you have seen. If
by some chance you have never seen a sparrow, I would first have to explain
what a sparrow was, and you would have to relate that to your experience
of seeing other types of bird. If you have never even seen a bird, then it
becomes more difficult, and I would have to think more carefully about how
to describe what a bird is to someone who has never seen one.
If I feel a pain in my leg, I can describe it to you, and you can relate
that description to your own experiences of having pain in your legs. But we
cannot feel the same pain. I cannot feel the pain in your leg, and you cannot
feel the pain in my leg. It is almost impossible for one person to know exactly
what pain another person is feeling. In fact we can argue that questions like
“Is my pain the same as your pain?” are ultimately meaningless, as there is
no meaningful way to make such comparisons.
This problem seems related to questions like “Is my feeling of seeing red
the same as your feeling of seeing red?”. However, the colour of objects is
something that can be specified in terms of physical theories about reflection
and absorption of light. We know that human colour perception depends
on reception of light by three specific types of colour receptor in the eye.
In as much as two people have exactly the same colour receptors (which is
mostly the case), there is some sense in which it can be said that they see the
same red if they look at the same object under the same lighting conditions.
Of course the internal processing of colour perceptions will still be different,
because it is very unlikely that two people’s brains are wired in exactly the
same way.
If we doubt that I am seeing the same red as you are seeing, we can use
a spectrograph to measure, for each frequency, the intensity of light falling
onto the red surface and the intensity of light reflected off the surface. Then,
for each frequency, the ratio between the intensity of light reflected off the
surface and the intensity of light falling onto the surface gives us the absolute
reflectance of the surface at that frequency. The values of all the ratios for
all the frequencies of light define the colour of the surface. We can display
these ratios as a function of frequency in a graph, or reduce them to a table
of numbers. There is no real possibility of us disagreeing about what the
numbers are. We can wonder if my experience of the number 3.567 is different
from your experience of the number 3.567, but most of us are prepared to
regard the meaning of “3.567” as completely independent of the person who
28
Proof of our Ignorance About Music
is reading the number.
This independence of observer is what we call objective. The opposite
of objective is subjective. The meaning of the number 3.567 is objective.
The pain in my leg is subjective.
Somewhere in between objective and subjective is inter-subjective. An
inter-subjective perception is subjective, but we have some degree of confidence
that my experience of it will be the same or at least similar to your
experience of it. Most subjective phenomena are inter-subjective to some
extent, in the sense that there is probably some person somewhere feeling
something similar to what you are feeling now, and that person would understand
what you were talking about if you described your feelings to them.
Even pain is inter-subjective in this sense. Also it could be claimed that the
difference between the objectivity of “seeing red” and the subjectivity of feeling
pain is not so much that it is impossible to objectively describe what pain
means, but just that our current understanding of the human mind and visual
perception allows us to be more specific about what “seeing red” means.
2.4.2 The Martian Scientist
In Oliver Sacks’ book An Anthropologist on Mars: Seven Paradoxical Tales
(Vintage, 1996), the “Martian” is Temple Grandin, a well-known autistic, who
has difficulty understanding the emotions and intentions of other people, and
who has described herself (as quoted on p. 248 in Sacks’ book) as feeling like
“an anthropologist from Mars”.
In general, the concept of the Martian Scientist is a good metaphor for
the idea that there are things about ourselves that we are very familiar with,
but which might be difficult to explain to an alien from outer space.
There is a presumption in this metaphor that there are at least some things
that we could explain to an alien scientist. For example, it is presumed that
it would not be too hard to introduce an alien scientist to our mathematical
notations, so that we could talk about “3.567”, and the alien scientist would
know exactly what we were talking about. Similarly we would be confident
that we could explain what a spectrograph was, and even explain the characteristics
of colour receptors in the human eye, so that our alien friend could
understand what we meant when we talked to him about the colour “red”.
The concept of the Martian Scientist arises in discussions about consciousness.
We all know subjectively what consciousness is, but as yet no one is
able to explain what it is in an objective scientific sense. Could we explain
consciousness to a Martian scientist? The problem is that a Martian scientist
is quite likely to be conscious in exactly the same way that we are. Maybe
it is not possible to be intelligent in a way that allows understanding and
discussion of scientific concepts, unless one is conscious. So when we talk
about consciousness with our friend from Mars, he could indicate that he
knows what we are talking about. And yet we cannot say that this proves
that either of us (human or Martian) has an objective understanding of what
29
What is Music?
consciousness is, because we may be doing nothing more than sharing our
common subjective experiences of consciousness with each other.
Music is a bit different in this regard. Our ability to respond to music
does not appear to play any essential role in our ability to comprehend the
universe. Our perception of music depends in obvious ways on our systems
for perceiving and processing sound. But being deaf does not in the least
imply a lack of intelligence: quite plausibly our Martian scientist could be
deaf. (Maybe the air on Mars is too thin for hearing to be of much use.) A
deaf Martian scientist would not have any subjective understanding of what
music is. This gives us a straightforward way to ask if we can find an objective
description of music: could we explain what music was to a deaf non-musical
Martian scientist?
Some people would explain music in terms of what they know about music,
saying music is a sequence of sounds according to certain rules, which happens
to have certain emotional effects on people. Given this explanation, and given
an item of supposed music, the Martian could check if the supposed music
satisfied the specified rules, and then check that it also had an effect on human
listeners. But what we really want to know is whether the Martian scientist
could learn to identify music, and in particular good music, when given only
the music itself. In other words, could the Martian scientist predict the effect
that an item of supposed music would have on human listeners? To use a
term that I am going to use a lot throughout this book, would the Martian
scientist be able to calculate the musicality of music?
2.4.3 The Incompleteness of Music Theory
It seems reasonable to assume that we could discuss mathematics with intelligent
aliens. So if we could produce a description of music that was mathematical,
then we could easily communicate that description to an alien scientist.
Much of music theory is mathematical. We will see details of this when
basic music theory is introduced in Chapter 4. Notes have frequencies. Intervals
between notes can be described as vectors and as certain fractional
ratios between their frequencies. Notes and percussive sounds occur at certain
times according to regular tempos. The relationships between fundamental
and harmonic frequencies can be explained in terms of Fourier analysis,
which is an important and non-trivial area of mathematics.
With all this existing mathematical music theory, we might wonder what
the problem is. Can’t we just tell our alien audience the mathematics of music
theory, and then they will have an objective understanding of what music is?
There are two main reasons why this might not be the case:
• Firstly, a mathematical description of music does not necessarily tell the
aliens anything about what is going on inside the human brain when
we listen to music.
30
Proof of our Ignorance About Music
• Secondly, our mathematical theory of music is not complete. Although
music theory says quite a lot about the mathematical structure of music,
it does not say enough to distinguish between really good music and
mediocre music. Music theory fails to predict the musicality of supposed
music.
These two problems are complementary: if we knew exactly what was
going on inside the human brain when we listened to music, then this information
could be translated into a procedure for calculating the musicality of
music. The procedure for calculating musicality would be a simulation of the
operation of those parts of the brain that play a role in perceiving music.
On the other hand, it may be possible to develop a complete mathematical
description of music without developing any understanding about what
happens inside the brain when we listen to music. But as you will see when
you progress through this book, intelligent guesswork about what is happening
inside the brain is the easiest way to make sense of the mathematical
structure of music.
The incompleteness of music theory was my major motivation for performing
the research which culminated in the development of the theories
explained in this book.
Books that discuss music theory tend to skate around the issue of incompleteness.
One good question to ask yourself, when reading a book (or
paper) that discusses explanations of music, is what, if anything, the book
says about why some music is better than other music. If an author ignores
or denies the existence of musicality as something that a musical item can
have more or less of, this makes it is easier for them to avoid confronting
the question of what it is that determines musicality, and they can comfort
themselves with discussions of “music”, completely ignoring any comparison
that can or should be made between “good” music and other music which is
still recognisable as music, but not quite so good.
Even when a book does arrive at this issue, the author will admit (sometimes
very implicitly), that they do not know what causes the difference
between the good and the not so good, or they may just state categorically
that this difference cannot be explained by “rules” (generally ignoring the
possibility that they are talking about known rules, and that there might be
other unknown rules that do explain the difference).
To approach a problem scientifically, we must not be afraid to confront
our own ignorance. The more clearly we can state what we think we know,
and what it is that we don’t know, the more chance we have of finding some
way to move forward. A precise statement of our ignorance about something
can be an important first step in the development of a new theory, or in the
design of an experiment likely to advance our understanding of the problem.
31
What is Music?
2.4.4 Musical Formulae
When people talk about music “written to a formula”, they use this phrase in
a derogatory sense, implying that some hack churns out musical items which
are all very similar and just good enough to be marketable. The sophisticated
listener is bored by this formulaic music, and hungers for musical creativity
that comes from an inspired genius whose output could never be captured by
anything as mundane as a formula.
No one ever says what the formula is. Or if they do, the formula suffers
from the same incompleteness as music theory in general: the formula
describes some aspect of the music, but it is not complete enough to generate
the same creative output as the output of the person whose output the
formula supposedly describes.
Now it is possible that someone somewhere is using a formula to generate
music, and they are keeping it a secret. If you had a formula to generate
music, you might want to keep it a secret too. You could use your formula to
compose music which you could sell, but if everyone knew the formula then it
would be too easy for anyone to make up good music, and the bottom would
drop out of the market.
The type of formula I have just been talking about is a formula to generate
music. In the world of mathematical computer science, they would call it an
algorithm (rather than a “formula”). An algorithm is something that can
be written down as a program written in some programming language, and
executed on a computer. So we are talking about a computer program that
can compose music, and not just any old music, but music that is as good
as, or even better than, the best music as currently composed by professional
composers and songwriters.
There is another type of algorithm which is relevant to the analysis of
music, and that is an algorithm that calculates the quality or musicality of
supposed music that is provided as input to the algorithm.
There is some degree of overlap between what these two types of algorithm
achieve, but they are not the same thing. The generative algorithmproduces
music which has high musicality. The predictive algorithm accepts as input
any music, or non-music, and tells what the musicality of that input is, and
predicts its effect on the human listener.
If we had a predictive algorithm, then a na¨ýve way to convert this to a
generative algorithm would be to attempt an exhaustive search of all possible
items of music, apply the predictive algorithm to each candidate, and output
each item for which the predicted musicality was found to be high enough.
This algorithm would work, but it might not be very efficient, because the
set of possible musical items grows large very quickly as we consider items of
greater and greater length, and only a very small proportion of all possible
tunes might be at all musical.
Similarly, if we had a generative algorithm, there is no guarantee that this
could be converted to an efficient predictive algorithm. Firstly, a particular
32
Proof of our Ignorance About Music
generative algorithm might not generate all possible strong pieces of music.
Secondly, even if it did, the only way to use it as a predictive algorithm would
be to run the algorithm and generate all possible items until one of them
happened to be the same as the input data. If the algorithm terminated, you
would know that your input data was musical. If it did not terminate, you
would then know that the input data was not musical (but of course it takes
an infinitely long time to determine that an algorithm does not terminate,
unless you are able to provide a mathematical proof of non-termination).
In practice, we would assume that effective generative algorithms and
effective predictive algorithms would both be based on a theoretical understanding
of the human response to music, and that given information that
could be used to formulate one type of algorithm, we could also formulate
the other type of algorithm without undue difficulty.
There are algorithms for which conversion into a related type of algorithm
is arbitrarily difficult and suffers from worst-case complexity.11 The standard
example is the cryptographic hash algorithm. This is an algorithm
that produces a fixed length output—the hash—typically 128 or 160 bits
long, which is derived from arbitrary sized input data, such as a computer
data file. The algorithm is irreversible in the sense that it is very difficult
to find an input value for a given hash value, unless you happen to already
know an input value that generates that hash value. And if you have one
input value that generates a hash value, it is equally difficult to discover a
second distinct input value that generates the same hash value. In fact a
cryptographic hash algorithm is considered broken if anyone ever discovers
any pair of distinct input values that produce the same hash value.
However, cryptographic hash algorithms have been specially designed to
be irreversible. In as much as music does not appear to be part of a biological
digital security system, there is no particular reason to suppose that
an algorithm for the evaluation of musicality could not be converted into an
algorithm for generating music with a high level of musicality. In fact, based
on the assumption that the human brain operates according to mathematically
specified physical laws, we already have a method which in principle
can generate high quality music: simulate the workings of the brains of those
people who (at least occasionally) compose good quality music.
2.4.5 The Economics of Musical Composition
I have hinted that finding a musical “formula” would radically change the
market for music. But what is the current state of the music composition
economy? Who composes the really good music? How do they do it? How
hard is it for them?
11Complexity is a computer science term meaning how much time and memory an
algorithm uses when executed in a computer, often specified as a function of the size of the
input data.
33
What is Music?
If existing well-known music theory was complete, then composing good
quality music would be relatively easy because the theory would tell us how
to do it. I would suggest that the existing economics of music implies that
the composition of high quality popular music is far from easy:
• Some composers and songwriters write a lot of music, but others only
ever write one or two very good items. This gives rise to the term “one
hit wonder” (although this is used more typically of performers, who
may or may not also be the composers of the music they perform).
• Some writers write a lot of good songs over a certain period, and then
seem to dry up.
• The record industry churns out best-selling albums, many of which
contain only one good song, with the rest being “album filler”.
• You can get paid a decent amount for making up some good music.
Generally nobody ever gets paid a whole lot for doing something that
anybody could have done.
We can see that whatever knowledge it is that composers and songwriters
have about music that allows them to write music, this knowledge does not
exist in a form that enables them to generate arbitrary amounts of new high
quality music. It is locked inside their brains as some type of intuitive understanding
of music which, when combined with persistence and good luck,
enables them to occasionally produce something great.
Trial and error may provide part of the explanation of how music is created:
an experienced musician is familiar with many different musical patterns
and structures, and combining this knowledge with their own subjective
ability to evaluate music, they can generate possible new music, listen to it
to see if it is any good, and remember the good stuff. Even when a new
piece of music suddenly “comes” to a composer, this may have been the final
result of an extended trial and error search that took place within the hidden
mechanisms of their brain (a Freudian would say that their subconscious
brain did all the work).
Although the inner workings of the brains of composers of great music is
an interesting topic in its own right, it is not the major purpose of this book
to explore the means by which people create new music. My primary focus is
on what causes people to respond to the music that they listen to. I cannot
rule out the possibility that learning more about musical composition might
help us to better understand the listener’s response to music, but in practice
we will find more direct routes to solving the problem of why and how we
respond to music.
The question of creation versus performance versus response cannot be
completely ignored when considering the biological purpose of music. Some
authors have suggested (and in some cases they just implicitly assume) that
34
Universality
the primary biological purpose of music has to do with creation and performance
rather than response to music. I do briefly consider these possibilities,
but I will show that there are reasons why hypotheses about the biological
purpose of creating and performing music are both unnecessary and unconvincing.
Consideration of the economics of music leads to what I call the luxury
yacht test (LYT) for a theory of music. It consists of the following steps:
• Discover a complete theory of music.
• The theory should specify an algorithm for calculating the musicality
of music, possibly parameterised for variations in musical taste.
• Reverse this algorithm to create an algorithm for generating new good
quality music.
• Sell the new music.
• Use the proceeds to purchase a luxury yacht.
So if you meet someone who claims to know the answer to the question
“What is music?”, ask them if they own a luxury yacht.
2.5 Universality
In the above discussion of musicality and predictive algorithms, I implicitly
assumed that there existed some measure of musicality that was equal for all
listeners. In practice there is a lot of commonality in musical taste, but the
very fact that the phrase “musical taste” exists in the language tells us that
musical preferences do vary from person to person.
It would be over-reacting to conclude that therefore an algorithmic and
scientific theory of music cannot be discovered. People vary in how they react
to strains of the flu, but that does not mean we cannot come to a scientific
understanding of the influenza virus and its effect on people.
What it does mean is that we will have to parameterise our algorithms
to take account of variations in musical taste. In other words, the algorithms
will accept additional input data representing information about the musical
taste of the listener. But, having said that, close enough is often good enough,
and if a particular algorithm generates high quality music according to your
tastes, then at least some of that music will also be considered high quality
music according to my musical tastes. Suppose that I like only 1% of the
music that you like, and we have an algorithm that generates new items of
music that you like. To generate one item of music that I like, all I have
to do is run the algorithm a hundred times. The 1% success rate (of this
hypothetical algorithm) is far superior to the (very close to 0%) success rate
of any currently known algorithm for generating music that I like.
35
What is Music?
The major factors likely to cause variations in musical taste are the following:
• Variations in exposure to music over one’s lifetime.
• Variations in exposure to other sensory inputs that affect response to
music (which could include language, non-verbal utterances, animal
sounds and other natural sounds).
• Variations in personality type.
• Genetic variations in whatever it is in our brain that determines our
response to music.
• Random/chaotic variations, i.e. points in the development of our bodies
and brains where something could just as easily have developed one way
as the other.
The most significant variations in musical exposure are where people belong
to totally different cultures and each culture has its own distinct type
of music. Not only are the tunes different, but the scales that the tunes live
on are different (although usually there are scales, and those scales usually
repeat every octave, but not always). The whole thing becomes relative: we
like our music and not their music, and they like their music but not our
music.
Cultural relativity spawns political correctness, and political correctness
can discourage researchers from following lines of enquiry that they might
otherwise follow. It might, for example, be deemed inappropriate to formulate
a hypothesis that suggests (or assumes) that the music from one culture is
“better” than the music from another culture.
The most politically incorrect candidate for a “best” type of music is
probably Western music, as played on Western scales (i.e. the notes on a
piano). Western music is coming to dominate over all other types of music,
occasionally including ideas and forms from other cultures, but mostly just
replacing them.12 Is this because Western music is better than other music?
Is it because Western countries are imperialistic and dominating? Is it all
caused by capitalistic marketing machines?
One circumstance which reduces the accessibility of non-Western music
to Western musicians is that most readily available musical instruments are
tuned to Western scales, i.e. the well-tempered chromatic scale or some subset
thereof. There may come a day when electronic keyboards routinely come
12The most substantial input into Western music from other cultures happened when
American-African slaves and their freed descendants combined aspects of African music and
Western music, giving rise to ragtime, jazz and blues. The African influence can probably
be held responsible for most of what makes modern popular music different from older
Western classical music. Despite this influence, Western popular music remains strongly
tied to the diatonic scale and to underlying regular hierarchical tempo.
36
Universality
with options to select alternative tunings, and when that day comes the dominance
of Western scales may be reduced somewhat, and alternative musics
may be able to reclaim some of their lost ground.
Even ignoring the political questions, there are theoretical issues, like:
• Does a theory have to take account of all known types of music?
• Can I develop a theory that just applies to one musical culture?
• If my theory describes some aspect of music, does that aspect have
to appear in all cultures, or in most cultures, or just in the biggest
cultures?
There is the idea of universality current among those who study music
(scientifically or otherwise), which is that theories about music have to apply
equally to all known musical cultures. On one level it is a perfectly valid
requirement, but if it is applied over-zealously then important sources of
information about music can end up being ignored.
The concept of universality is being applied too strongly if it is used to
reject any theory or hypothesis that cannot immediately be applied to all
forms and genres of music from all musical cultures that have ever existed.
There is a useful analogy with the study of biology and the study of
specific biological organisms. In studying biology we expect to find general
principles that underlie the workings of all living species. At the same time,
the biologist cannot simultaneously study all organisms at one time. He or
she must necessarily concentrate their studies on one particular species, and
indeed often just on one or a few members of that species. Eventually some of
what is learned about particular species will turn out to generalise to theories
that apply to many different species, or even to all species, but we cannot
expect or require this generalisation to happen immediately every time we
develop a new theory about something.
The criterion for accepting a scientific theory as being useful is not whether
it unifies all knowledge in a domain, but rather that it unifies at least some
set of distinct facts.
For example, it would be entirely possible and legitimate to develop a scientific
theory about a single melody. Our observation of the melody could be
regarded as a series of observations of individual musical notes. The occurrence
of each note in the melody—its time, length and pitch—counts as one
fact about the melody. The theory about the melody would be an explanation
that described the notes in some way that was simpler and shorter than a full
listing of the notes. Having found a theory about this one melody, we would
hope that it could be generalised in some way to form a theory about other
melodies, or even all melodies. But even if this is not immediately possible,
the theory still has value if it can say something significant about just the
one melody.
37
What is Music?
It follows that we should not feel guilty if we happen to develop theories
of music that only apply to certain musical cultures, or to certain genres, or
to the musical taste of one person (e.g. the person who developed the theory).
The eventual aim of a theory of music is to be universal, and the theory I
develop in this book certainly claims to be universal. But a theory about
some aspect of music is not wrong or irrelevant just because it is not quite as
universal as it could be.
2.5.1 Author’s Declaration
Having justified the development of non-universal theories of music, it is
perhaps now safe for me to declare my own musical tastes and preferences:
• Most of the music I listen to is the sort of thing you will hear on “Top
of the Pops”.
• Almost all the music I listen to is diatonic music with regular hierarchical
tempo.
• I do not listen to, and do not enjoy, atonal music.
• I do not listen to classical music that much.
• I do not think that John Cage’s infamous “4 minutes 33 seconds” is
music.
The last example gets a mention in the introduction to The Origins of
Music (see the next chapter for more discussion of the contents of this book
and others), as part of the difficulty inherent in defining what music is, and
it’s not entirely clear if they are joking or not.
2.6 Scientific Theories
2.6.1 Testability and Falsifiability
The relationship between facts and theories is a large part of what science is
about.
Consider a simple example: I throw a ball into the air in a certain direction.
I take photos of its path with a camera that can take pictures rapidly
at regular intervals. From the photos I record a series of positions at different
times. The path and the recorded positions will look something like
Figure 2.2.
I have a theory about the path of my ball. Writing t for time, x for
horizontal position and y for height above some baseline, my theory can be
written as a pair of equations that specify position as a function of time:
38
Scientific Theories
x = vxt
y = vyt -
1
2
gt2
vx represents initial horizontal velocity, vy represents initial vertical velocity,
and g represents acceleration due to gravity.
vx
vy
g
Figure 2.2. A ball thrown into the air with initial horizontal velocity vx,
vertical velocity vy and downward acceleration g. The camera takes a photo of
the ball’s position at t = 0, t = 1, t = 2, etc.
The most important thing about the theory in relation to the facts is
that the theory is specified using a fixed amount of information (i.e. those
two equations), but it can explain a larger number of facts. In this case the
number of facts that can be explained by the theory is virtually unlimited,
because we can measure a large number of positions each time we throw the
ball, and we can throw the ball any number of times, perhaps with different
values of vx and vy each time.
Sometimes theories explain facts that can only be gleaned by observation,
and the supply of facts may be more limited—a good example would be any
theory that explains the positions of the planets, as we cannot easily throw
new planets into space and observe them (although modern technology does
allow one to fire small spaceships out into space). However, as long as the
amount of information contained in the observations explained by our theory
is larger than the amount of information contained in the specification of
the theory, we can be confident that the theory is saying something useful
about the world. We can be especially confident if the set of observations
explained by the theory keeps on growing, without the theory itself requiring
39
What is Music?
any further improvement or adjustment.
There are a number of things that we can say about the ball example,
which reflect on issues that arise generally when doing science:
• The theory can be related to more general theories. For example, the
acceleration comes from gravity, and we can form a more general theory
about gravity. The theory about gravity will tell us that g depends on
height above the Earth, and that it has quite a different value if you
happen to do the experiment standing on the moon.
• The theory is only approximately correct, in part because it makes
various assumptions that are not quite true. Air resistance is ignored.
It is assumed that the gravitational field is constant. (If we threw the
ball hard enough to go into orbit, then the equation would turn out to
be quite inaccurate.) Any effects due to the ball itself having a finite
extent are ignored.
• The measurements of the ball’s position will not be made with 100%
accuracy. We will have to allow for this when verifying the theory
against the data.
• We may not have any independent way of knowing the values of vx
and vy, and they will have to be estimated from the data itself in each
case. One consequence of this is that at least 3 data points have to be
taken in order check the theory at all, since for any 2 data points there
will be values of vx and vy that exactly match the data. If we don’t
know beforehand what g is, then its value also has to be calculated from
the data, and at least 4 data points are required to be able to check
anything. (We would, however, expect g to have the same value for
different throws of the ball.)
• If we don’t have a camera that can take pictures at regular intervals, it
will be very difficult to do this experiment at all.
These issues all have to do with the concept of testability, or falsifia-
bility. If we state a scientific theory, we expect it to make predictions about
something; a theory that doesn’t make any predictions that can be checked
isn’t really a theory. We then want to be able to compare the predictions with
measurements and observations. If the predictions come out wrong, then the
theory is falsified, i.e. proven wrong. We can never prove a theory true, but
it becomes more convincing if it makes more and more predictions and never
gets proven wrong.
This view is somewhat idealised—that a scientific theory is falsifiable by
experimental observation and is rejected the moment it is contradicted by
just one observation. Sometimes we have to be a bit forgiving of our theories,
for various reasons:
40
Scientific Theories
• Sometimes a theory cannot be tested by any practical means, at least
not when it is formulated, but it is testable in principle. Our theory
about the thrown ball is difficult to test if we don’t have the equipment
for measuring its position at known times. Scientists sometimes
deal with this difficulty by specifying thought experiments, i.e. experiments
carried out only in their imaginations. If we don’t have a
camera that can shoot pictures at regular intervals, we can still imagine
the existence of such a camera, and use this possibility to justify the
testability of the theory about the position of a ball thrown into the
air. Albert Einstein was famous for inventing thought experiments that
tested certain aspects of quantum theory.13
• Sometimes the “facts” that disprove a theory turn out to be wrong.
• A theory may explain a whole lot of facts, and then fail on just one
fact. Even if that one fact is quite reliable, and it disproves the theory,
the theory is still telling us something about all the other facts that it
does correctly predict. We know that the theory needs to be replaced
with a better theory, but we don’t throw away the old theory until we
have found the new theory. In fact it becomes a requirement that any
new theory should explain why the old theory works as well as it does.
This sort of thing happened when special relativity “replaced” Newtonian
physics,14 and also when quantum mechanics replaced Newtonian
physics (again).
2.6.2 Simplicity and Complexity
Science often progresses in a certain area because someone asks the right
questions and does the right experiments. Real life phenomena can be very
complicated, and theoretical descriptions of these phenomena must take into
account many different factors. It is best if we can separate out the individual
factors as much as possible.
In our thrown ball example, we remarked that air resistance was ignored.
If we had tried throwing a piece of paper, or a feather, then it would have
been impossible to ignore air resistance. We would not have been able to
verify the theory contained in our simple equations. Now even an ordinary
ball—like a tennis ball—might be affected by air resistance by a noticeable
amount. If we had some idea that air resistance was a complicating factor,
then we might guess that we could ignore it if the object being thrown was
large and dense. Instead of throwing a tennis ball, we might choose to throw a
13Einstein was sure that the theory couldn’t be correct, and the thought experiments
(published in 1935 by Einstein and two other physicists, Boris Podolsky and Nathan Rosen)
were intended to prove this—he believed that the results predicted by the theory were too
strange to be possible. But when slightly altered versions of the thought experiments were
carried out decades later, the results of the experiments confirmed the theory.
14But they still teach Newtonian physics in school.
41
What is Music?
solid iron ball. We would be rewarded by a very close fit to our mathematical
equation, because the size and density of the solid iron ball would allow us
to ignore air resistance.
By using a heavier ball, we have created a simpler phenomenon to study.
If we didn’t even know what the equation was going to be, we could have made
observations on throwing the heavy ball, and looked for simple patterns in
the data. For example, using the method of differences,15 it would have
been easy to discover the formula for height as a function of time.
In the case of music, we don’t necessarily have a clear idea as to what all
the complicating factors are, and whether they can be cleanly separated from
each other. But there is one easy way we can avoid complexity, and that is
to study the simplest tunes possible.
This means, given a choice between a symphony and a pop song, where
the symphony has hundreds of bars, multiple motifs, several key changes and
a whole orchestra of instruments, and the pop song has 12 bars, 3 chords,
one melody, no key changes and can be performed by one guy singing while
strumming a guitar, study the pop song first.
There is a tendency in musical academia to listen to “difficult” music, such
as long complex symphonies, and strange contemporary music that ordinary
folk don’t listen to. If popular music is studied, this is done so apologetically.
But when we realise that music is a difficult scientific problem, and it has
been studied for over 2000 years, and everyone is still clueless as to what
music actually is, then no apology should be necessary. We should study the
absolute simplest stuff possible. Even when studying pop music, we should
simplify it as much as we can without rendering it unmusical. Is it just a
melody line? Maybe, maybe not. Can we reduce the accompaniment to a
simple chord sequence (like in a “Learn to Play Guitar” book)? Can we
reduce the bass to just the root note of the chord? Can we leave out the
rhythm accompaniment, or reduce it to a straightforward pattern of regular
beats?
Another good example of scientific simplification is found in biology. Biologists
have studied many different organisms, both complex and simple. But
some of the most important discoveries in genetics and molecular biology
have been made using the simplest possible organisms. The relationship between
DNA and protein was discovered using viruses, which are usually just
a small section of DNA wrapped in some protein. Other problems required
self-contained organisms (viruses are always parasites), in which case bacteria
were used as the object of study. And to study the mechanisms of development
in multi-cellular organisms, a very simple multi-cellular organism was
chosen: Caenorhabditis elegans, a 1mm soil nematode which not only has a
15Given a sequence of values, keep taking the differences of each element in the sequence
and the next to get a new sequence, and repeat this procedure. If you arrive at a sequence
of all zeros, you can reconstruct a polynomial which describes the original set of values,
such that the degree of the polynomial is one less than the number of times the procedure
was applied.
42
Scientific Theories
relatively small number of cells in its body, it contains an exact number of
somatic cells as a fully developed adult—959. (Somatic cells are non-germ
cells, i.e. those cells that are not destined to become ancestors of the cells in
the organism’s descendants.)
In all these cases, the biologists did not go around apologising for studying
organisms that were too easy or too simple.
A more extreme example, where scientists can only solve the easiest version
of the problem, is the dynamics of multi-body gravitational systems
assuming Newtonian gravity: the interaction of two bodies in each other’s
gravitational fields is soluble with an analytical solution,16 but solving for
three bodies is too hard, except for certain special cases. Something similar
is found when studying the quantum mechanics of the atom: the hydrogen
atom with one nucleus and one electron is doable, the helium atom with one
nucleus and two electrons is too hard, and scientists must resort to various
approximations, or to brute force integration of the relevant equations on big
computers.
If the calculations of the consequences of a theory cannot be calculated accurately
(because we are not studying the simplest possible system described
by the theory), then the predictions of the theory cannot easily be checked
against the results of our observations. And if there is no simple equation
that describes the behaviour of the system, there is much less chance that we
will discover the theory describing the system just by analysing observations
of its behaviour. This is demonstrated by the last example: significant discoveries
about the quantum nature of the atom were made from observations
of spectral lines of the hydrogen atom, which happen to exhibit certain simple
regular patterns.17 Similarly, Newton’s discovery of universal gravity was
helped by Kepler’s discovery of the laws of planetary motion, which take a
simple form because for each planet one can (to a first approximation) ignore
the gravitational effect of all other bodies besides the Sun.
16An analytical solution is one that can be written down as a formula that you can work
out on a basic scientific calculator, i.e. only containing algebraic operations, trigonometric
and exponential functions, and their inverses.
17Hydrogen: The Essential Element by John S. Rigden (Harvard University Press, 2002)
gives a very good account of how the simplicity of the hydrogen atom has contributed to
the development of scientific knowledge.
43
The problem with answering the question “What is music?” is understanding
what would constitute a proper answer. Music arises
from human behaviour, and the study of human behaviour is part
of biology. So any question about music is a question about biology,
and every question about biology requires an answer within
the framework of Darwin’s theory of evolution by natural selection.
2.1 Music is Something We Like
What is music? It’s what comes out of the speakers when we play a CD
on our stereo. It’s what we hear on the radio. Music is singers singing and
musicians playing. Music is a sound that we enjoy hearing.
Is this a proper answer to the question “What is music?”?
If I asked “What is a car?”, you could answer by pointing at a large
object moving up the street and saying “It’s one of those.” But this may
not be a satisfactory answer. A full explanation of what a car is would
mention petrol, internal combustion engines, brakes, suspension, transmission
and other mechanical things that make a car go. And we don’t just want to
know what a car is; we also want to know what a car is for. An explanation
of what a car is for would include the facts that there are people and other
things (like shopping) inside cars and that the purpose of cars is to move
people and things from one place to another.
By analogy, a good answer to the question “What is music?” will say
something about the detailed mechanics of music: instruments, notes, scales,
rhythm, tempo, chords, harmony, bass and melody. This matches up with
the mechanical portion of our car explanation. It’s harder to answer the
18 Copyright
c 2004, 2005 Philip Dorrell
The Biology of Feeling Good
“What is it for?” part of the question. A simple answer is that music is
enjoyable—it makes us “feel good”. We could expand on this a bit and say
that music creates emotions, or interacts with the emotions we already feel
and, sometimes, it makes us want to dance.
2.2 The Biology of Feeling Good
The “feel good” explanation is worth something, but it isn’t entirely satisfactory.
Or, at least, it’s not satisfactory if you’re a professional theoretical
biologist.
What does music have to do with biology? Music is something that people
create and something that people respond to. People are living organisms,
and biology is the study of living organisms.
We can compare music to eating. Eating is a well-known activity. People
do it. Animals do it. We know what eating is: it is the ingestion of certain
substances into our digestive systems. The ingested substances, or food,
travel through the digestive system, where components of those substances
are broken down and extracted by various means for use within the body.
Leftover portions of the food get pushed out the other end.
We can explain eating at a psychological level: we eat when we feel hungry
because it makes us feel good. Being “hungry” can be defined as a feeling
of wanting to eat food. We can determine that we become hungry when we
haven’t eaten for a while,1 and that we stay hungry (and slowly get hungrier)
until we have eaten.
2.2.1 Having More Grandchildren
A professional biologist would explain the existence of hunger by saying that
it is adaptive or, equivalently, that it is an adaptation.
A biologist calls something an adaptation if it contributes to having more
grandchildren. Becoming hungry when we need to eat and eating when we
are hungry contribute to having more grandchildren in the following ways:
• As children we need to eat food to grow up into adults.
• We need to eat to have the strength and energy to survive, to secure a
mate, to do the mating itself, and then do all the work that comes afterwards,
i.e. raise the children. In particular, we need to raise our children
well enough that they can grow up and have children themselves.
• When a woman is pregnant, and also when she is breast feeding, she
needs to “eat for two”.
1There are other factors that influence hunger, such as whether it’s the time of day at
which we normally eat.
19
What is Music?
• We shouldn’t eat when we already have enough food in us, because:
– too much food at once will overload our digestive system,
– once we have enough food in us, there are other more important
things we should be doing instead of eating more food.
I refer to the need to contribute to having more grandchildren, rather than
just children, to emphasise the importance of the continued cycle of birth,
growth, development and reproduction. If something causes us to have more
children, but has a negative effect on the ability of our children to raise their
own children, to such an extent that it causes us to have fewer grandchildren,
then that something is not an adaptation.
Strictly speaking, biologists think in terms of long-term reproductive suc-
cess, i.e. having great-grandchildren and great-great-grandchildren, and so on
forever. But, for our purposes, “grandchildren” is a close enough approximation.
By the time most people get to having grandchildren, they no longer
have the major responsibility to raise them, so whatever enabled their reproductive
success to get that far will probably continue indefinitely anyway.
What made biologists think that everything had to be explained in terms
of having more grandchildren? Most people would concede that if some
species of organism does not have grandchildren, then pretty soon it is not
going to exist at all. But does that mean that every purposeful behaviour
of a living organism has to be explained in terms of long-term reproductive
success?
2.2.2 Charles Darwin and His Theory
The most important discovery in the history of biology was Charles Darwin’s
theory of evolution by natural selection.
Even today, when his theory underpins all of modern biology, there are
many people who refuse to believe that his theory is correct, or even that it
could be correct. More than a hundred and forty years after Charles Darwin
published his discovery, there is a whole industry of authors and pseudoscientists
“proving” that evolution does not occur, or that if it does occur
then it is not occurring by natural selection.
This book is not aiming to change the minds of people who are skeptical
about evolution. This is a science book, and it is based on a scientific point
of view that the universe we live in appears to be comprehensible in the way
that Albert Einstein remarked upon, and that furthermore it is reasonable
to proceed on the basis that those bits of the universe that we do not yet
comprehend will eventually turn out to be comprehensible.
The specific field of study concerned with understanding human behaviour
according to Darwin’s theory of evolution by natural selection is evolution-
ary psychology. The basic assumption of evolutionary psychology is that
20
The Biology of Feeling Good
our behaviour is determined in some manner and to some degree by our
genes.
Genes are the information about how our bodies develop and operate.
They are contained in molecules called DNA, which can be understood as
long strings of text written in a language with a 4-letter molecular “alphabet”.
If you read molecular biology papers in scientific journals, you will
see descriptions of genes written as strings containing the letters A, G, T
and C. These are the first letters of the chemical names for the four molecular
“letters” in the molecular alphabet: adenine, guanine, thymine and
cytosine.
AGTTTCTAGGTCGTGAAACTGTTCAGGCTTAAGTTGCGGTA
Figure 2.1. A stretch of (single-stranded) DNA shown as a sequence of A, G,
T and C.
For humans the strings of DNA are divided up into 23 pairs of chromo-
somes. Each chromosome is an unbroken stretch of DNA, usually tied up
in complex spiral patterns (to keep it safe and out of harm’s way when it is
not being used). Every cell in your body has these 23 pairs of chromosomes,
except for a few types of cell that don’t need to reproduce themselves. (Also
there are the gametes which are the intermediate stage between parent and
child, and which have only one of each pair of chromosomes.) The chromosomes
in each pair are similar to each other,2 and we get one of each type
of chromosome from each parent (via their gametes). For each pair of chromosomes,
each of our parents supplies one chromosome from their own pair
of chromosomes, or a mixture of both chromosomes in that pair. Darwin
didn’t know about DNA, and he didn’t understand the mechanics of genetic
shuffling and mixing that occurs when we have sex.3
When we reproduce, the central thing that reproduces is our DNA. For
us, as multi-cellular organisms, this happens when we reproduce to create
new organisms (i.e. babies), and also when the cells that make up our own
bodies reproduce in order to make our tissues grow. Most of the time the
DNA reproduces accurately, but bits of it can get changed or mutated. And
when these mutations occur, they will on average be preserved, and the next
time the DNA reproduces, the parts of the gene that were changed are no
2Exception: females have two X chromosomes, but males have one X chromosome and
one Y chromosome per cell. Furthermore, one of the female X chromosomes is always
rendered inactive within the cell.
3Gregor Mendel was the one who first learned about the genetics of sex. The science
of genetics as we know it today began when Mendel did his experiments on sweet peas.
Darwin’s theory of genetics involved a theory of “blending”, which didn’t work very well.
Unfortunately Mendel’s work did not become widely known until some time after Darwin’s
death.
21
What is Music?
more likely to change the next time than any other part of the gene that was
not changed.4
What happens to us if our DNA mutates? A lot of the time the answer
is nothing, because much of the information in our DNA has little effect on
how well our bodies work. In fact the notion of “gene” specifically refers to
a portion of DNA which does affect some particular part of how our body
develops or operates. Mostly this happens when a gene encodes the makeup
of a particular type of molecule called a protein. There are many types of
proteins that do many different things in our bodies. If DNA in one of your
genes changes, then the protein encoded by the gene will change, and this
could affect how the protein does whatever it does in your body. Ultimately,
the changed protein could change your long-term reproductive success.5 It
might make it better, or it might make it worse (which is actually far more
likely). If it makes it better, then you are going to have more grandchildren
and great-grandchildren and so on. If it makes it worse, then you are going
to have fewer grandchildren and great-grandchildren and so on than everyone
else.
An important part of Darwin’s theory is the idea that for every species
there is some limit as to how many individuals of that species can ever exist
at one time. Among other considerations, all life that we know of exists on
planet Earth, and the Earth is finite in size. In practice, most species hit
some limit long before they get to the point where their members occupy
every square and cubic inch of the planet. As the more successful genetic
variations form a constantly increasing proportion of the total population,
the less successful genetic variations must eventually disappear altogether.
When this happens, the species itself has undergone a permanent change.
The removal of less successful variations is the natural selection and the
resulting permanent change is the evolution.
Darwin realised that if the process of evolution went on for long enough,
species could change into new species that were as different from their ancestors
as different species are from each other. And if species sometimes
split into separate populations, and those populations happened to evolve in
different directions, then one species would turn into two or more species.
Taking this idea to its logical conclusion, Darwin supposed that all life on
Earth could have evolved from a single ancestral species:
Therefore I should infer from analogy that probably all the organic
beings which have ever lived on this earth have descended from some
one primordial form, into which life was first breathed.6
4This is probably not 100% true, as some locations in the chromosome may be more
susceptible to processes that cause mutation. It is more precise to state that the probability
of mutation at any given location on the chromosome can be a function of location, but
does not depend on whether the location in question has or has not recently suffered a
mutation.
5A mutation will affect your descendants if it occurs in a germ cell, which is a cell
from which the gametes (sperms or eggs) are descended.
22
Explaining Purposeful Behaviour
The modern technical term for this hypothetical “one primordial form” is
the Universal Common Ancestor (UCA).
Evolution by natural selection explains the characteristics of living organisms.
Each living organism is the result of a long sequence of individual minor
changes, and each minor change became fixed in the population because it
resulted in increased reproductive success. There are a few caveats to this
reasoning:
• Some changes may have resulted from genetic changes that had only a
very marginal effect on reproductive success. There is a certain probability
that some changes will become permanent even though they
have no effect or even a slightly negative effect on reproductive success.
This can happen particularly if a species is occasionally reduced to a
very small population, or if a new species evolves from a very small
sub-population of its ancestor species.7
• In some cases an observable aspect of a species’ behaviour will be attributable
to the effects of one or more evolved changes that occurred
in the past, but this aspect may not currently contribute to reproductive
success, even though the corresponding evolutionary changes did
contribute to reproductive success at the time they occurred.
2.3 Explaining Purposeful Behaviour
Whether or not a particular aspect of human behaviour requires to be explained
within the evolutionary framework is easier to decide if we restrict
ourselves to consideration of purposeful behaviour.
Purpose can be defined as a type of reverse causality. Causality is something
that flows forward in time. What was explains what is, and what is
explains what will be. With explanations involving purpose it’s the other way
around: what is explains what was, and what will be explains what is.
A normal causal explanation might be applied to a soccer player kicking
a ball that goes into goal: the ball with mass m was travelling at velocity
v1, when it made contact with the player’s foot (via his boot) at position p1,
which caused it to change velocity to v2, after which, according to the laws of
physics, it travelled in a path that caused it to go into the goal. In the causal
explanation, where and how the player kicked the ball determined the ball’s
path, which in turn determined the ball’s final destination inside the goal.
In the purposeful or teleological explanation, the ball going into the goal
explains the way that the player kicked the ball. That is, the result is treated
as the explanation of the events that caused that result. “The player kicked
6The Origin of Species Charles Darwin 1859
7Motoo Kimura developed the neutral theory of molecular evolution which emphasises
the importance of random (non-selective) processes in evolution.
23
What is Music?
the ball so that it would go into the goal.” If the ball had initially been in
a different location and travelling in a different direction, the player would
have kicked it differently, but he still would have kicked it in a way that would
have caused it to go into the goal.
Of course players don’t always get the ball into goal, even if they try (“try”
is a word whose meaning implicitly assumes purpose), but we still accept the
explanation that goes backwards in time: the player kicked the ball the way
he did because he was trying to get it into goal (and it nearly went in).
This distinction between causal explanations and teleological explanations
goes all the way back to Aristotle: he used the term efficient cause to describe
normal forward causality, and final cause to describe reverse teleological
causality.8
Modern science only admits efficient causes. A very simple way of justifying
this is to say that science only allows one explanation for any particular
aspect of reality that requires explanation. If we have two explanations of
the same phenomenon, either one explanation is not correct, or one of the
explanations is redundant and could have been restated in terms of the other.
In the case of the soccer player kicking the ball into goal, we accept the
correctness of both explanations: the ball went into the goal because of the
way it was kicked, and the ball was kicked the way it was so that it could go
into the goal. But these dual explanations only apply to purposeful phenomena.
For all other phenomena only the efficient cause type of explanation ever
applies. So we may assume that efficient causes are the more basic type of
explanation, and we must look for a way to restate the final cause explanation
in terms of efficient causes.
At which point we can directly apply Darwin’s theory of evolution by
natural selection. It is the cycle of reproduction and selection which converts
efficient causes into final causes. Various soccer players try to kick the ball
into the goal. The ones that get it in are seen as better players. The girls
fall in love with the good soccer players, and they have lots of children. The
children inherit the genes from their dads who were good soccer players, and
some of these genes determine the behaviour that caused their dads to kick
the ball into the goal. Maybe the genes give their owners stronger legs, or
better coordination, or create a propensity to practice more, or give them a
tendency to party less the night before an important match. Whatever the
case, in the next generation of soccer players there is a higher proportion of
those genes which make the players better at kicking balls into the goal.
This explanation does seem a little trite. The genes that contribute to
players being able to kick accurately may be genes that have quite general
effects, like being able to focus on achieving a result, or being able to develop
coordinated action. The ancestors of a good soccer player may never actually
have played soccer (or at least not professionally). They might have been
8Aristotle listed two other types of cause: material and formal, but we would tend to
include them as parts of efficient and final causes respectively.
24
Explaining Purposeful Behaviour
cricket players instead. Or perhaps the skills evolved to help them run away
from lions and throw spears at edible prey animals.9
But the general idea holds good: natural selection converts a final cause
explanation into an efficient cause explanation, protecting and preserving the
unity of all scientific explanations.
It also means we can stop feeling guilty about using teleological explanations,
as long as they fit into the theory of evolution by natural selection.10
Final causes can be chained together just like efficient causes. For example,
a chain of efficient causes is: I was able to have many grandchildren
because the girls liked me because I got rich because I kicked the ball into
the goal because I had practiced a lot because I always arrived at practice on
time. The corresponding chain of final causes is: I always arrived at soccer
practice on time so that I could consistently kick the ball into the goal so that
I could get rich from being paid well, so that all the girls would love me and I
could choose the best one to marry so that I could have many grandchildren.
We can use Darwin’s theory of evolution by natural selection to convert a
final cause explanation into an efficient cause explanation, as long as the very
last final cause in the chain of final causes is lots of grandchildren. If we end
up with a final cause of something else, then our teleological explanation is
not consistent with our otherwise consistent explanation of reality based on
efficient causes.
2.3.1 Incorrect or Apparently Incorrect Sub-Goals
Where does music fit in to this theory of purpose and causality? Certainly we
can identify purposeful causality in behaviours relating to music. “I worked
at the shop so that I could save up money so that I could buy a fuzz box so
that I could plug it into my guitar so that I could play ‘Smoke on the Water’.”
But the chain of final causes seems to stop when we get to the music itself.
Many of the unsolved problems of evolutionary science involve the existence
of final causes that appear not to have any explanation in terms of
more grandchildren: the chain comes to a stop in a bad place. Any number
of human behaviours seem to go directly against what is required for maximising
long-term reproductive success, behaviours such as driving too fast,
9This is a reference to the environment of evolutionary adaptedness (EEA): the
time when we lived in the jungle in hunter/gatherer tribes. The presumption is that not
much evolution has happened between that time and the present day, so any evolutionary
explanations must relate to those earlier circumstances as opposed to modern living conditions
with cars, roads, supermarkets etc. The EEA (as an explanation for modern human
behaviour) is discussed in more detail in Chapter 3.
10This is not a complete explanation of the existence of purpose in human (or animal)
behaviour: in addition to natural selection, there are selective processes operating within
the brain, which act to select those behaviours and behavioural strategies that (on average)
help us to satisfy our biological goals. The physiological mechanisms that underlie these
processes are themselves the result of evolution by natural selection, so there exists a twolevel
hierarchy of purposeful causality: natural selection has given rise to a purposeful
system of internal selection which acts to select purposeful behaviours.
25
What is Music?
sky-diving, being generous, fighting for your country, eating too much fat (or
just eating too much), eating sticky sweets that make your teeth go rotten,
and drinking too much alcohol.
How can we explain the existence of these apparently non-adaptive purposeful
behaviours? Plausible types of explanation include the following:
• The reproductive benefit is there, but just not so obvious to the untrained
observer.
• The purposeful behaviour results from some more general purpose which
benefits reproductive success on average.
• The behaviour used to benefit reproductive success, but times have
changed and now it doesn’t.
(The third explanation can be a special case of the second one: the behaviour
used to benefit reproductive success, now it doesn’t; in the future
it may become beneficial again.) Another possible explanation is that the
alleged behaviour isn’t quite what it seems: for example, maybe generosity
isn’t quite as common as it appears to be, because people are always doing
things to make themselves appear more generous than they really are.
Trying to explain non-adaptive purposes and purposeful behaviours is an
ongoing activity in the world of evolutionary psychology, and some of the
explanations that have been thought of are more convincing than others.
Here is a sample list of evolutionary explanations for some of the apparently
non-adaptive human behaviours given above:
• Wanting to drive too fast used not to be non-adaptive, because there
weren’t any cars. The instincts that make drivers want to drive too fast
had general benefits, encouraging our ancestors to learn how to move
quickly and efficiently without crashing into anything.
• There weren’t any opportunities to sky-dive in the distant past, on account
of the non-existence of parachutes—so a desire to sky-dive would
not have been non-adaptive.
• Dying for your tribe or country seems extremely non-adaptive, since
dead people can’t have children. But if society rewards warriors who
risk their lives for the sake of the tribe, then it can be argued that the
benefits going to those who risk their lives and survive more than make
up for the losses suffered by those who risk their lives and get killed.
• Eating a lot of fat can be beneficial if there is a substantial risk of
famine. The extra nutrients stored in the body of a fat person will help
them to survive the hard times.
26
Proof of our Ignorance About Music
• In the past, most available sweet foods would have been either ripe
fruit or honey. These are not quite as bad for your teeth as the boiled
sweets and toffees that are available in large quantities in the modern
supermarket. A desire to eat anything sweet is of particular advantage
to children, as they need the extra energy to play, and play is important
because it helps children develop their thinking and general life skills.
• Why people like to drink alcohol requires a different sort of explanation.
Alcohol and other recreational drugs, legal or illegal, act directly on
those parts of the brain that tell us if we have or have not achieved
our goals. The most that evolutionary theory can tell us about drugs
is that if a drug was widely available in the distant past, then humans
should have evolved some resistance to that drug.
2.4 Proof of our Ignorance About Music
This issue of explaining non-adaptive purposes will come up when we investigate
music. With music there is, however, a further complication: we don’t
even know what music is. Music is therefore a double mystery: we don’t
know the “what” and we don’t know the “why”. Maybe if we could solve
the “what” that would help us answer the “why”, or maybe if we could guess
what the “why” is we could find out the “what”.
There are a number of different ways I have found of demonstrating our
ignorance of what music is, and each provides a useful insight into the nature
of the problem:
• Subjective and Objective. The difference between knowing what
something is subjectively and knowing what it is objectively.
• The Martian Scientist. Could we explain to a Martian scientist what
music is?
• The Incompleteness of Music Theory. Here “music theory” refers
to the kind of music theory that you learn when you learn to play music,
and which will be presented in a basic form in Chapter 4. This music
theory tells us something about the structure of music, but beyond a
certain point it gives up.
• Lack of Formula. Despite common claims that some types of music
are “written to a formula”, there is no such formula, or if there is one,
no one is telling us what it is.
• The Economics of Music. Those who compose good music get paid
well, because making up good music is a hard problem. The very difficulty
of the problem results from our ignorance about what music is.
27
What is Music?
2.4.1 Subjective and Objective
We know what we know about things in the world around us because information
comes into our senses, and we process the information in our nervous
systems and brains to create knowledge about those things. Sometimes we
can convert this knowledge into symbolic natural language, i.e. by speaking
or writing. Sometimes other people can relate our symbolic descriptions of
things to their own experiences of the same things (or similar things).
If I see a sparrow, I can describe my observations of that sparrow to you.
You can relate that description to memories of sparrows you have seen. If
by some chance you have never seen a sparrow, I would first have to explain
what a sparrow was, and you would have to relate that to your experience
of seeing other types of bird. If you have never even seen a bird, then it
becomes more difficult, and I would have to think more carefully about how
to describe what a bird is to someone who has never seen one.
If I feel a pain in my leg, I can describe it to you, and you can relate
that description to your own experiences of having pain in your legs. But we
cannot feel the same pain. I cannot feel the pain in your leg, and you cannot
feel the pain in my leg. It is almost impossible for one person to know exactly
what pain another person is feeling. In fact we can argue that questions like
“Is my pain the same as your pain?” are ultimately meaningless, as there is
no meaningful way to make such comparisons.
This problem seems related to questions like “Is my feeling of seeing red
the same as your feeling of seeing red?”. However, the colour of objects is
something that can be specified in terms of physical theories about reflection
and absorption of light. We know that human colour perception depends
on reception of light by three specific types of colour receptor in the eye.
In as much as two people have exactly the same colour receptors (which is
mostly the case), there is some sense in which it can be said that they see the
same red if they look at the same object under the same lighting conditions.
Of course the internal processing of colour perceptions will still be different,
because it is very unlikely that two people’s brains are wired in exactly the
same way.
If we doubt that I am seeing the same red as you are seeing, we can use
a spectrograph to measure, for each frequency, the intensity of light falling
onto the red surface and the intensity of light reflected off the surface. Then,
for each frequency, the ratio between the intensity of light reflected off the
surface and the intensity of light falling onto the surface gives us the absolute
reflectance of the surface at that frequency. The values of all the ratios for
all the frequencies of light define the colour of the surface. We can display
these ratios as a function of frequency in a graph, or reduce them to a table
of numbers. There is no real possibility of us disagreeing about what the
numbers are. We can wonder if my experience of the number 3.567 is different
from your experience of the number 3.567, but most of us are prepared to
regard the meaning of “3.567” as completely independent of the person who
28
Proof of our Ignorance About Music
is reading the number.
This independence of observer is what we call objective. The opposite
of objective is subjective. The meaning of the number 3.567 is objective.
The pain in my leg is subjective.
Somewhere in between objective and subjective is inter-subjective. An
inter-subjective perception is subjective, but we have some degree of confidence
that my experience of it will be the same or at least similar to your
experience of it. Most subjective phenomena are inter-subjective to some
extent, in the sense that there is probably some person somewhere feeling
something similar to what you are feeling now, and that person would understand
what you were talking about if you described your feelings to them.
Even pain is inter-subjective in this sense. Also it could be claimed that the
difference between the objectivity of “seeing red” and the subjectivity of feeling
pain is not so much that it is impossible to objectively describe what pain
means, but just that our current understanding of the human mind and visual
perception allows us to be more specific about what “seeing red” means.
2.4.2 The Martian Scientist
In Oliver Sacks’ book An Anthropologist on Mars: Seven Paradoxical Tales
(Vintage, 1996), the “Martian” is Temple Grandin, a well-known autistic, who
has difficulty understanding the emotions and intentions of other people, and
who has described herself (as quoted on p. 248 in Sacks’ book) as feeling like
“an anthropologist from Mars”.
In general, the concept of the Martian Scientist is a good metaphor for
the idea that there are things about ourselves that we are very familiar with,
but which might be difficult to explain to an alien from outer space.
There is a presumption in this metaphor that there are at least some things
that we could explain to an alien scientist. For example, it is presumed that
it would not be too hard to introduce an alien scientist to our mathematical
notations, so that we could talk about “3.567”, and the alien scientist would
know exactly what we were talking about. Similarly we would be confident
that we could explain what a spectrograph was, and even explain the characteristics
of colour receptors in the human eye, so that our alien friend could
understand what we meant when we talked to him about the colour “red”.
The concept of the Martian Scientist arises in discussions about consciousness.
We all know subjectively what consciousness is, but as yet no one is
able to explain what it is in an objective scientific sense. Could we explain
consciousness to a Martian scientist? The problem is that a Martian scientist
is quite likely to be conscious in exactly the same way that we are. Maybe
it is not possible to be intelligent in a way that allows understanding and
discussion of scientific concepts, unless one is conscious. So when we talk
about consciousness with our friend from Mars, he could indicate that he
knows what we are talking about. And yet we cannot say that this proves
that either of us (human or Martian) has an objective understanding of what
29
What is Music?
consciousness is, because we may be doing nothing more than sharing our
common subjective experiences of consciousness with each other.
Music is a bit different in this regard. Our ability to respond to music
does not appear to play any essential role in our ability to comprehend the
universe. Our perception of music depends in obvious ways on our systems
for perceiving and processing sound. But being deaf does not in the least
imply a lack of intelligence: quite plausibly our Martian scientist could be
deaf. (Maybe the air on Mars is too thin for hearing to be of much use.) A
deaf Martian scientist would not have any subjective understanding of what
music is. This gives us a straightforward way to ask if we can find an objective
description of music: could we explain what music was to a deaf non-musical
Martian scientist?
Some people would explain music in terms of what they know about music,
saying music is a sequence of sounds according to certain rules, which happens
to have certain emotional effects on people. Given this explanation, and given
an item of supposed music, the Martian could check if the supposed music
satisfied the specified rules, and then check that it also had an effect on human
listeners. But what we really want to know is whether the Martian scientist
could learn to identify music, and in particular good music, when given only
the music itself. In other words, could the Martian scientist predict the effect
that an item of supposed music would have on human listeners? To use a
term that I am going to use a lot throughout this book, would the Martian
scientist be able to calculate the musicality of music?
2.4.3 The Incompleteness of Music Theory
It seems reasonable to assume that we could discuss mathematics with intelligent
aliens. So if we could produce a description of music that was mathematical,
then we could easily communicate that description to an alien scientist.
Much of music theory is mathematical. We will see details of this when
basic music theory is introduced in Chapter 4. Notes have frequencies. Intervals
between notes can be described as vectors and as certain fractional
ratios between their frequencies. Notes and percussive sounds occur at certain
times according to regular tempos. The relationships between fundamental
and harmonic frequencies can be explained in terms of Fourier analysis,
which is an important and non-trivial area of mathematics.
With all this existing mathematical music theory, we might wonder what
the problem is. Can’t we just tell our alien audience the mathematics of music
theory, and then they will have an objective understanding of what music is?
There are two main reasons why this might not be the case:
• Firstly, a mathematical description of music does not necessarily tell the
aliens anything about what is going on inside the human brain when
we listen to music.
30
Proof of our Ignorance About Music
• Secondly, our mathematical theory of music is not complete. Although
music theory says quite a lot about the mathematical structure of music,
it does not say enough to distinguish between really good music and
mediocre music. Music theory fails to predict the musicality of supposed
music.
These two problems are complementary: if we knew exactly what was
going on inside the human brain when we listened to music, then this information
could be translated into a procedure for calculating the musicality of
music. The procedure for calculating musicality would be a simulation of the
operation of those parts of the brain that play a role in perceiving music.
On the other hand, it may be possible to develop a complete mathematical
description of music without developing any understanding about what
happens inside the brain when we listen to music. But as you will see when
you progress through this book, intelligent guesswork about what is happening
inside the brain is the easiest way to make sense of the mathematical
structure of music.
The incompleteness of music theory was my major motivation for performing
the research which culminated in the development of the theories
explained in this book.
Books that discuss music theory tend to skate around the issue of incompleteness.
One good question to ask yourself, when reading a book (or
paper) that discusses explanations of music, is what, if anything, the book
says about why some music is better than other music. If an author ignores
or denies the existence of musicality as something that a musical item can
have more or less of, this makes it is easier for them to avoid confronting
the question of what it is that determines musicality, and they can comfort
themselves with discussions of “music”, completely ignoring any comparison
that can or should be made between “good” music and other music which is
still recognisable as music, but not quite so good.
Even when a book does arrive at this issue, the author will admit (sometimes
very implicitly), that they do not know what causes the difference
between the good and the not so good, or they may just state categorically
that this difference cannot be explained by “rules” (generally ignoring the
possibility that they are talking about known rules, and that there might be
other unknown rules that do explain the difference).
To approach a problem scientifically, we must not be afraid to confront
our own ignorance. The more clearly we can state what we think we know,
and what it is that we don’t know, the more chance we have of finding some
way to move forward. A precise statement of our ignorance about something
can be an important first step in the development of a new theory, or in the
design of an experiment likely to advance our understanding of the problem.
31
What is Music?
2.4.4 Musical Formulae
When people talk about music “written to a formula”, they use this phrase in
a derogatory sense, implying that some hack churns out musical items which
are all very similar and just good enough to be marketable. The sophisticated
listener is bored by this formulaic music, and hungers for musical creativity
that comes from an inspired genius whose output could never be captured by
anything as mundane as a formula.
No one ever says what the formula is. Or if they do, the formula suffers
from the same incompleteness as music theory in general: the formula
describes some aspect of the music, but it is not complete enough to generate
the same creative output as the output of the person whose output the
formula supposedly describes.
Now it is possible that someone somewhere is using a formula to generate
music, and they are keeping it a secret. If you had a formula to generate
music, you might want to keep it a secret too. You could use your formula to
compose music which you could sell, but if everyone knew the formula then it
would be too easy for anyone to make up good music, and the bottom would
drop out of the market.
The type of formula I have just been talking about is a formula to generate
music. In the world of mathematical computer science, they would call it an
algorithm (rather than a “formula”). An algorithm is something that can
be written down as a program written in some programming language, and
executed on a computer. So we are talking about a computer program that
can compose music, and not just any old music, but music that is as good
as, or even better than, the best music as currently composed by professional
composers and songwriters.
There is another type of algorithm which is relevant to the analysis of
music, and that is an algorithm that calculates the quality or musicality of
supposed music that is provided as input to the algorithm.
There is some degree of overlap between what these two types of algorithm
achieve, but they are not the same thing. The generative algorithmproduces
music which has high musicality. The predictive algorithm accepts as input
any music, or non-music, and tells what the musicality of that input is, and
predicts its effect on the human listener.
If we had a predictive algorithm, then a na¨ýve way to convert this to a
generative algorithm would be to attempt an exhaustive search of all possible
items of music, apply the predictive algorithm to each candidate, and output
each item for which the predicted musicality was found to be high enough.
This algorithm would work, but it might not be very efficient, because the
set of possible musical items grows large very quickly as we consider items of
greater and greater length, and only a very small proportion of all possible
tunes might be at all musical.
Similarly, if we had a generative algorithm, there is no guarantee that this
could be converted to an efficient predictive algorithm. Firstly, a particular
32
Proof of our Ignorance About Music
generative algorithm might not generate all possible strong pieces of music.
Secondly, even if it did, the only way to use it as a predictive algorithm would
be to run the algorithm and generate all possible items until one of them
happened to be the same as the input data. If the algorithm terminated, you
would know that your input data was musical. If it did not terminate, you
would then know that the input data was not musical (but of course it takes
an infinitely long time to determine that an algorithm does not terminate,
unless you are able to provide a mathematical proof of non-termination).
In practice, we would assume that effective generative algorithms and
effective predictive algorithms would both be based on a theoretical understanding
of the human response to music, and that given information that
could be used to formulate one type of algorithm, we could also formulate
the other type of algorithm without undue difficulty.
There are algorithms for which conversion into a related type of algorithm
is arbitrarily difficult and suffers from worst-case complexity.11 The standard
example is the cryptographic hash algorithm. This is an algorithm
that produces a fixed length output—the hash—typically 128 or 160 bits
long, which is derived from arbitrary sized input data, such as a computer
data file. The algorithm is irreversible in the sense that it is very difficult
to find an input value for a given hash value, unless you happen to already
know an input value that generates that hash value. And if you have one
input value that generates a hash value, it is equally difficult to discover a
second distinct input value that generates the same hash value. In fact a
cryptographic hash algorithm is considered broken if anyone ever discovers
any pair of distinct input values that produce the same hash value.
However, cryptographic hash algorithms have been specially designed to
be irreversible. In as much as music does not appear to be part of a biological
digital security system, there is no particular reason to suppose that
an algorithm for the evaluation of musicality could not be converted into an
algorithm for generating music with a high level of musicality. In fact, based
on the assumption that the human brain operates according to mathematically
specified physical laws, we already have a method which in principle
can generate high quality music: simulate the workings of the brains of those
people who (at least occasionally) compose good quality music.
2.4.5 The Economics of Musical Composition
I have hinted that finding a musical “formula” would radically change the
market for music. But what is the current state of the music composition
economy? Who composes the really good music? How do they do it? How
hard is it for them?
11Complexity is a computer science term meaning how much time and memory an
algorithm uses when executed in a computer, often specified as a function of the size of the
input data.
33
What is Music?
If existing well-known music theory was complete, then composing good
quality music would be relatively easy because the theory would tell us how
to do it. I would suggest that the existing economics of music implies that
the composition of high quality popular music is far from easy:
• Some composers and songwriters write a lot of music, but others only
ever write one or two very good items. This gives rise to the term “one
hit wonder” (although this is used more typically of performers, who
may or may not also be the composers of the music they perform).
• Some writers write a lot of good songs over a certain period, and then
seem to dry up.
• The record industry churns out best-selling albums, many of which
contain only one good song, with the rest being “album filler”.
• You can get paid a decent amount for making up some good music.
Generally nobody ever gets paid a whole lot for doing something that
anybody could have done.
We can see that whatever knowledge it is that composers and songwriters
have about music that allows them to write music, this knowledge does not
exist in a form that enables them to generate arbitrary amounts of new high
quality music. It is locked inside their brains as some type of intuitive understanding
of music which, when combined with persistence and good luck,
enables them to occasionally produce something great.
Trial and error may provide part of the explanation of how music is created:
an experienced musician is familiar with many different musical patterns
and structures, and combining this knowledge with their own subjective
ability to evaluate music, they can generate possible new music, listen to it
to see if it is any good, and remember the good stuff. Even when a new
piece of music suddenly “comes” to a composer, this may have been the final
result of an extended trial and error search that took place within the hidden
mechanisms of their brain (a Freudian would say that their subconscious
brain did all the work).
Although the inner workings of the brains of composers of great music is
an interesting topic in its own right, it is not the major purpose of this book
to explore the means by which people create new music. My primary focus is
on what causes people to respond to the music that they listen to. I cannot
rule out the possibility that learning more about musical composition might
help us to better understand the listener’s response to music, but in practice
we will find more direct routes to solving the problem of why and how we
respond to music.
The question of creation versus performance versus response cannot be
completely ignored when considering the biological purpose of music. Some
authors have suggested (and in some cases they just implicitly assume) that
34
Universality
the primary biological purpose of music has to do with creation and performance
rather than response to music. I do briefly consider these possibilities,
but I will show that there are reasons why hypotheses about the biological
purpose of creating and performing music are both unnecessary and unconvincing.
Consideration of the economics of music leads to what I call the luxury
yacht test (LYT) for a theory of music. It consists of the following steps:
• Discover a complete theory of music.
• The theory should specify an algorithm for calculating the musicality
of music, possibly parameterised for variations in musical taste.
• Reverse this algorithm to create an algorithm for generating new good
quality music.
• Sell the new music.
• Use the proceeds to purchase a luxury yacht.
So if you meet someone who claims to know the answer to the question
“What is music?”, ask them if they own a luxury yacht.
2.5 Universality
In the above discussion of musicality and predictive algorithms, I implicitly
assumed that there existed some measure of musicality that was equal for all
listeners. In practice there is a lot of commonality in musical taste, but the
very fact that the phrase “musical taste” exists in the language tells us that
musical preferences do vary from person to person.
It would be over-reacting to conclude that therefore an algorithmic and
scientific theory of music cannot be discovered. People vary in how they react
to strains of the flu, but that does not mean we cannot come to a scientific
understanding of the influenza virus and its effect on people.
What it does mean is that we will have to parameterise our algorithms
to take account of variations in musical taste. In other words, the algorithms
will accept additional input data representing information about the musical
taste of the listener. But, having said that, close enough is often good enough,
and if a particular algorithm generates high quality music according to your
tastes, then at least some of that music will also be considered high quality
music according to my musical tastes. Suppose that I like only 1% of the
music that you like, and we have an algorithm that generates new items of
music that you like. To generate one item of music that I like, all I have
to do is run the algorithm a hundred times. The 1% success rate (of this
hypothetical algorithm) is far superior to the (very close to 0%) success rate
of any currently known algorithm for generating music that I like.
35
What is Music?
The major factors likely to cause variations in musical taste are the following:
• Variations in exposure to music over one’s lifetime.
• Variations in exposure to other sensory inputs that affect response to
music (which could include language, non-verbal utterances, animal
sounds and other natural sounds).
• Variations in personality type.
• Genetic variations in whatever it is in our brain that determines our
response to music.
• Random/chaotic variations, i.e. points in the development of our bodies
and brains where something could just as easily have developed one way
as the other.
The most significant variations in musical exposure are where people belong
to totally different cultures and each culture has its own distinct type
of music. Not only are the tunes different, but the scales that the tunes live
on are different (although usually there are scales, and those scales usually
repeat every octave, but not always). The whole thing becomes relative: we
like our music and not their music, and they like their music but not our
music.
Cultural relativity spawns political correctness, and political correctness
can discourage researchers from following lines of enquiry that they might
otherwise follow. It might, for example, be deemed inappropriate to formulate
a hypothesis that suggests (or assumes) that the music from one culture is
“better” than the music from another culture.
The most politically incorrect candidate for a “best” type of music is
probably Western music, as played on Western scales (i.e. the notes on a
piano). Western music is coming to dominate over all other types of music,
occasionally including ideas and forms from other cultures, but mostly just
replacing them.12 Is this because Western music is better than other music?
Is it because Western countries are imperialistic and dominating? Is it all
caused by capitalistic marketing machines?
One circumstance which reduces the accessibility of non-Western music
to Western musicians is that most readily available musical instruments are
tuned to Western scales, i.e. the well-tempered chromatic scale or some subset
thereof. There may come a day when electronic keyboards routinely come
12The most substantial input into Western music from other cultures happened when
American-African slaves and their freed descendants combined aspects of African music and
Western music, giving rise to ragtime, jazz and blues. The African influence can probably
be held responsible for most of what makes modern popular music different from older
Western classical music. Despite this influence, Western popular music remains strongly
tied to the diatonic scale and to underlying regular hierarchical tempo.
36
Universality
with options to select alternative tunings, and when that day comes the dominance
of Western scales may be reduced somewhat, and alternative musics
may be able to reclaim some of their lost ground.
Even ignoring the political questions, there are theoretical issues, like:
• Does a theory have to take account of all known types of music?
• Can I develop a theory that just applies to one musical culture?
• If my theory describes some aspect of music, does that aspect have
to appear in all cultures, or in most cultures, or just in the biggest
cultures?
There is the idea of universality current among those who study music
(scientifically or otherwise), which is that theories about music have to apply
equally to all known musical cultures. On one level it is a perfectly valid
requirement, but if it is applied over-zealously then important sources of
information about music can end up being ignored.
The concept of universality is being applied too strongly if it is used to
reject any theory or hypothesis that cannot immediately be applied to all
forms and genres of music from all musical cultures that have ever existed.
There is a useful analogy with the study of biology and the study of
specific biological organisms. In studying biology we expect to find general
principles that underlie the workings of all living species. At the same time,
the biologist cannot simultaneously study all organisms at one time. He or
she must necessarily concentrate their studies on one particular species, and
indeed often just on one or a few members of that species. Eventually some of
what is learned about particular species will turn out to generalise to theories
that apply to many different species, or even to all species, but we cannot
expect or require this generalisation to happen immediately every time we
develop a new theory about something.
The criterion for accepting a scientific theory as being useful is not whether
it unifies all knowledge in a domain, but rather that it unifies at least some
set of distinct facts.
For example, it would be entirely possible and legitimate to develop a scientific
theory about a single melody. Our observation of the melody could be
regarded as a series of observations of individual musical notes. The occurrence
of each note in the melody—its time, length and pitch—counts as one
fact about the melody. The theory about the melody would be an explanation
that described the notes in some way that was simpler and shorter than a full
listing of the notes. Having found a theory about this one melody, we would
hope that it could be generalised in some way to form a theory about other
melodies, or even all melodies. But even if this is not immediately possible,
the theory still has value if it can say something significant about just the
one melody.
37
What is Music?
It follows that we should not feel guilty if we happen to develop theories
of music that only apply to certain musical cultures, or to certain genres, or
to the musical taste of one person (e.g. the person who developed the theory).
The eventual aim of a theory of music is to be universal, and the theory I
develop in this book certainly claims to be universal. But a theory about
some aspect of music is not wrong or irrelevant just because it is not quite as
universal as it could be.
2.5.1 Author’s Declaration
Having justified the development of non-universal theories of music, it is
perhaps now safe for me to declare my own musical tastes and preferences:
• Most of the music I listen to is the sort of thing you will hear on “Top
of the Pops”.
• Almost all the music I listen to is diatonic music with regular hierarchical
tempo.
• I do not listen to, and do not enjoy, atonal music.
• I do not listen to classical music that much.
• I do not think that John Cage’s infamous “4 minutes 33 seconds” is
music.
The last example gets a mention in the introduction to The Origins of
Music (see the next chapter for more discussion of the contents of this book
and others), as part of the difficulty inherent in defining what music is, and
it’s not entirely clear if they are joking or not.
2.6 Scientific Theories
2.6.1 Testability and Falsifiability
The relationship between facts and theories is a large part of what science is
about.
Consider a simple example: I throw a ball into the air in a certain direction.
I take photos of its path with a camera that can take pictures rapidly
at regular intervals. From the photos I record a series of positions at different
times. The path and the recorded positions will look something like
Figure 2.2.
I have a theory about the path of my ball. Writing t for time, x for
horizontal position and y for height above some baseline, my theory can be
written as a pair of equations that specify position as a function of time:
38
Scientific Theories
x = vxt
y = vyt -
1
2
gt2
vx represents initial horizontal velocity, vy represents initial vertical velocity,
and g represents acceleration due to gravity.
vx
vy
g
Figure 2.2. A ball thrown into the air with initial horizontal velocity vx,
vertical velocity vy and downward acceleration g. The camera takes a photo of
the ball’s position at t = 0, t = 1, t = 2, etc.
The most important thing about the theory in relation to the facts is
that the theory is specified using a fixed amount of information (i.e. those
two equations), but it can explain a larger number of facts. In this case the
number of facts that can be explained by the theory is virtually unlimited,
because we can measure a large number of positions each time we throw the
ball, and we can throw the ball any number of times, perhaps with different
values of vx and vy each time.
Sometimes theories explain facts that can only be gleaned by observation,
and the supply of facts may be more limited—a good example would be any
theory that explains the positions of the planets, as we cannot easily throw
new planets into space and observe them (although modern technology does
allow one to fire small spaceships out into space). However, as long as the
amount of information contained in the observations explained by our theory
is larger than the amount of information contained in the specification of
the theory, we can be confident that the theory is saying something useful
about the world. We can be especially confident if the set of observations
explained by the theory keeps on growing, without the theory itself requiring
39
What is Music?
any further improvement or adjustment.
There are a number of things that we can say about the ball example,
which reflect on issues that arise generally when doing science:
• The theory can be related to more general theories. For example, the
acceleration comes from gravity, and we can form a more general theory
about gravity. The theory about gravity will tell us that g depends on
height above the Earth, and that it has quite a different value if you
happen to do the experiment standing on the moon.
• The theory is only approximately correct, in part because it makes
various assumptions that are not quite true. Air resistance is ignored.
It is assumed that the gravitational field is constant. (If we threw the
ball hard enough to go into orbit, then the equation would turn out to
be quite inaccurate.) Any effects due to the ball itself having a finite
extent are ignored.
• The measurements of the ball’s position will not be made with 100%
accuracy. We will have to allow for this when verifying the theory
against the data.
• We may not have any independent way of knowing the values of vx
and vy, and they will have to be estimated from the data itself in each
case. One consequence of this is that at least 3 data points have to be
taken in order check the theory at all, since for any 2 data points there
will be values of vx and vy that exactly match the data. If we don’t
know beforehand what g is, then its value also has to be calculated from
the data, and at least 4 data points are required to be able to check
anything. (We would, however, expect g to have the same value for
different throws of the ball.)
• If we don’t have a camera that can take pictures at regular intervals, it
will be very difficult to do this experiment at all.
These issues all have to do with the concept of testability, or falsifia-
bility. If we state a scientific theory, we expect it to make predictions about
something; a theory that doesn’t make any predictions that can be checked
isn’t really a theory. We then want to be able to compare the predictions with
measurements and observations. If the predictions come out wrong, then the
theory is falsified, i.e. proven wrong. We can never prove a theory true, but
it becomes more convincing if it makes more and more predictions and never
gets proven wrong.
This view is somewhat idealised—that a scientific theory is falsifiable by
experimental observation and is rejected the moment it is contradicted by
just one observation. Sometimes we have to be a bit forgiving of our theories,
for various reasons:
40
Scientific Theories
• Sometimes a theory cannot be tested by any practical means, at least
not when it is formulated, but it is testable in principle. Our theory
about the thrown ball is difficult to test if we don’t have the equipment
for measuring its position at known times. Scientists sometimes
deal with this difficulty by specifying thought experiments, i.e. experiments
carried out only in their imaginations. If we don’t have a
camera that can shoot pictures at regular intervals, we can still imagine
the existence of such a camera, and use this possibility to justify the
testability of the theory about the position of a ball thrown into the
air. Albert Einstein was famous for inventing thought experiments that
tested certain aspects of quantum theory.13
• Sometimes the “facts” that disprove a theory turn out to be wrong.
• A theory may explain a whole lot of facts, and then fail on just one
fact. Even if that one fact is quite reliable, and it disproves the theory,
the theory is still telling us something about all the other facts that it
does correctly predict. We know that the theory needs to be replaced
with a better theory, but we don’t throw away the old theory until we
have found the new theory. In fact it becomes a requirement that any
new theory should explain why the old theory works as well as it does.
This sort of thing happened when special relativity “replaced” Newtonian
physics,14 and also when quantum mechanics replaced Newtonian
physics (again).
2.6.2 Simplicity and Complexity
Science often progresses in a certain area because someone asks the right
questions and does the right experiments. Real life phenomena can be very
complicated, and theoretical descriptions of these phenomena must take into
account many different factors. It is best if we can separate out the individual
factors as much as possible.
In our thrown ball example, we remarked that air resistance was ignored.
If we had tried throwing a piece of paper, or a feather, then it would have
been impossible to ignore air resistance. We would not have been able to
verify the theory contained in our simple equations. Now even an ordinary
ball—like a tennis ball—might be affected by air resistance by a noticeable
amount. If we had some idea that air resistance was a complicating factor,
then we might guess that we could ignore it if the object being thrown was
large and dense. Instead of throwing a tennis ball, we might choose to throw a
13Einstein was sure that the theory couldn’t be correct, and the thought experiments
(published in 1935 by Einstein and two other physicists, Boris Podolsky and Nathan Rosen)
were intended to prove this—he believed that the results predicted by the theory were too
strange to be possible. But when slightly altered versions of the thought experiments were
carried out decades later, the results of the experiments confirmed the theory.
14But they still teach Newtonian physics in school.
41
What is Music?
solid iron ball. We would be rewarded by a very close fit to our mathematical
equation, because the size and density of the solid iron ball would allow us
to ignore air resistance.
By using a heavier ball, we have created a simpler phenomenon to study.
If we didn’t even know what the equation was going to be, we could have made
observations on throwing the heavy ball, and looked for simple patterns in
the data. For example, using the method of differences,15 it would have
been easy to discover the formula for height as a function of time.
In the case of music, we don’t necessarily have a clear idea as to what all
the complicating factors are, and whether they can be cleanly separated from
each other. But there is one easy way we can avoid complexity, and that is
to study the simplest tunes possible.
This means, given a choice between a symphony and a pop song, where
the symphony has hundreds of bars, multiple motifs, several key changes and
a whole orchestra of instruments, and the pop song has 12 bars, 3 chords,
one melody, no key changes and can be performed by one guy singing while
strumming a guitar, study the pop song first.
There is a tendency in musical academia to listen to “difficult” music, such
as long complex symphonies, and strange contemporary music that ordinary
folk don’t listen to. If popular music is studied, this is done so apologetically.
But when we realise that music is a difficult scientific problem, and it has
been studied for over 2000 years, and everyone is still clueless as to what
music actually is, then no apology should be necessary. We should study the
absolute simplest stuff possible. Even when studying pop music, we should
simplify it as much as we can without rendering it unmusical. Is it just a
melody line? Maybe, maybe not. Can we reduce the accompaniment to a
simple chord sequence (like in a “Learn to Play Guitar” book)? Can we
reduce the bass to just the root note of the chord? Can we leave out the
rhythm accompaniment, or reduce it to a straightforward pattern of regular
beats?
Another good example of scientific simplification is found in biology. Biologists
have studied many different organisms, both complex and simple. But
some of the most important discoveries in genetics and molecular biology
have been made using the simplest possible organisms. The relationship between
DNA and protein was discovered using viruses, which are usually just
a small section of DNA wrapped in some protein. Other problems required
self-contained organisms (viruses are always parasites), in which case bacteria
were used as the object of study. And to study the mechanisms of development
in multi-cellular organisms, a very simple multi-cellular organism was
chosen: Caenorhabditis elegans, a 1mm soil nematode which not only has a
15Given a sequence of values, keep taking the differences of each element in the sequence
and the next to get a new sequence, and repeat this procedure. If you arrive at a sequence
of all zeros, you can reconstruct a polynomial which describes the original set of values,
such that the degree of the polynomial is one less than the number of times the procedure
was applied.
42
Scientific Theories
relatively small number of cells in its body, it contains an exact number of
somatic cells as a fully developed adult—959. (Somatic cells are non-germ
cells, i.e. those cells that are not destined to become ancestors of the cells in
the organism’s descendants.)
In all these cases, the biologists did not go around apologising for studying
organisms that were too easy or too simple.
A more extreme example, where scientists can only solve the easiest version
of the problem, is the dynamics of multi-body gravitational systems
assuming Newtonian gravity: the interaction of two bodies in each other’s
gravitational fields is soluble with an analytical solution,16 but solving for
three bodies is too hard, except for certain special cases. Something similar
is found when studying the quantum mechanics of the atom: the hydrogen
atom with one nucleus and one electron is doable, the helium atom with one
nucleus and two electrons is too hard, and scientists must resort to various
approximations, or to brute force integration of the relevant equations on big
computers.
If the calculations of the consequences of a theory cannot be calculated accurately
(because we are not studying the simplest possible system described
by the theory), then the predictions of the theory cannot easily be checked
against the results of our observations. And if there is no simple equation
that describes the behaviour of the system, there is much less chance that we
will discover the theory describing the system just by analysing observations
of its behaviour. This is demonstrated by the last example: significant discoveries
about the quantum nature of the atom were made from observations
of spectral lines of the hydrogen atom, which happen to exhibit certain simple
regular patterns.17 Similarly, Newton’s discovery of universal gravity was
helped by Kepler’s discovery of the laws of planetary motion, which take a
simple form because for each planet one can (to a first approximation) ignore
the gravitational effect of all other bodies besides the Sun.
16An analytical solution is one that can be written down as a formula that you can work
out on a basic scientific calculator, i.e. only containing algebraic operations, trigonometric
and exponential functions, and their inverses.
17Hydrogen: The Essential Element by John S. Rigden (Harvard University Press, 2002)
gives a very good account of how the simplicity of the hydrogen atom has contributed to
the development of scientific knowledge.
43
Subscribe to:
Posts (Atom)
By: Robert Shorn;
Date Added.: Nov 19, 2010;
Category: